EMAIL THIS PAGE TO A FRIEND

C1orf226

chromosome 1 open reading frame 226

Species: Human C1orf226(400793)
UniProtKB ID: A1L170, B4DF31
Gene ID:
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001085375 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001085375 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001085375 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU104121 MISSION® esiRNA esiRNA human C1orf226 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085375 Rosetta Predictions human pricing
XM_378908 Rosetta Predictions human pricing
XM_930558 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317526 predicted 1146
2 SASI_Hs02_00317527 predicted 473
3 SASI_Hs02_00317528 predicted 1152
4 SASI_Hs02_00317529 predicted 571
5 SASI_Hs02_00317530 predicted 349
6 SASI_Hs02_00317531 predicted 734
7 SASI_Hs02_00317532 predicted 527
8 SASI_Hs02_00317533 predicted 609
9 SASI_Hs02_00317534 predicted 766
10 SASI_Hs02_00317535 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_378908 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00282761 predicted 1332
2 SASI_Hs01_00282762 predicted 464
3 SASI_Hs01_00282763 predicted 1180
4 SASI_Hs01_00282764 predicted 1323
5 SASI_Hs01_00282765 predicted 566
6 SASI_Hs01_00282766 predicted 735
7 SASI_Hs01_00282767 predicted 529
8 SASI_Hs01_00282768 predicted 600
9 SASI_Hs01_00282769 predicted 967
10 SASI_Hs01_00282770 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930558 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00256908 predicted 503
2 SASI_Hs01_00256909 predicted 1208
3 SASI_Hs01_00256910 predicted 1182
4 SASI_Hs01_00256911 predicted 601
5 SASI_Hs01_00256912 predicted 764
6 SASI_Hs01_00256913 predicted 555
7 SASI_Hs01_00256914 predicted 628
8 SASI_Hs01_00256915 predicted 831
9 SASI_Hs01_00256916 predicted 796
10 SASI_Hs01_00256917 predicted 423
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085375
C1orf226 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 226
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000264181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085375.1-570s21c1
Sequence:CCGGCCACCCAGGACATGCTGATTTCTCGAGAAATCAGCATGTCCTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085375.1-3963s21c1
Sequence:CCGGTGCAATCCATCAGCGTTTAAACTCGAGTTTAAACGCTGATGGATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085375.1-519s21c1
Sequence:CCGGTGGATCCTCCACCTCCCATAACTCGAGTTATGGGAGGTGGAGGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085375.1-760s21c1
Sequence:CCGGCCTGTCAGTACCTGACCTAATCTCGAGATTAGGTCAGGTACTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085375
C1orf226 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 226
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000264181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085375.1-570s21c1
Sequence:CCGGCCACCCAGGACATGCTGATTTCTCGAGAAATCAGCATGTCCTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085375.1-3963s21c1
Sequence:CCGGTGCAATCCATCAGCGTTTAAACTCGAGTTTAAACGCTGATGGATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085375.1-519s21c1
Sequence:CCGGTGGATCCTCCACCTCCCATAACTCGAGTTATGGGAGGTGGAGGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085375.1-760s21c1
Sequence:CCGGCCTGTCAGTACCTGACCTAATCTCGAGATTAGGTCAGGTACTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085375
C1orf226 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 226
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000264181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085375.1-570s21c1
Sequence:CCGGCCACCCAGGACATGCTGATTTCTCGAGAAATCAGCATGTCCTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085375.1-3963s21c1
Sequence:CCGGTGCAATCCATCAGCGTTTAAACTCGAGTTTAAACGCTGATGGATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085375.1-519s21c1
Sequence:CCGGTGGATCCTCCACCTCCCATAACTCGAGTTATGGGAGGTGGAGGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085375.1-760s21c1
Sequence:CCGGCCTGTCAGTACCTGACCTAATCTCGAGATTAGGTCAGGTACTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks