EMAIL THIS PAGE TO A FRIEND

C1orf227

chromosome 1 open reading frame 227

Species: Human C1orf227(149643)
UniProtKB ID: Q537H7
Gene ID:
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024601 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001024601 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001024601 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024601 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024601 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183040 predicted 222
2 SASI_Hs01_00183041 predicted 226
3 SASI_Hs01_00183042 predicted 225
4 SASI_Hs01_00183043 predicted 202
5 SASI_Hs01_00183044 predicted 211
6 SASI_Hs01_00183046 predicted 194
7 SASI_Hs01_00183047 predicted 222
8 SASI_Hs01_00183048 predicted 193
9 SASI_Hs01_00183049 predicted 215
10 SASI_Hs02_00307183 predicted 204
11 SASI_Hs01_00183045 predicted 216
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024601
C1orf227 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 227
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024601.1-148s1c1
Sequence:CCGGCATGGAGTAAGCAAACAACATCTCGAGATGTTGTTTGCTTACTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024601.1-217s1c1
Sequence:CCGGCGAAGCAATCAAGTCAGCTTACTCGAGTAAGCTGACTTGATTGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024601.1-229s1c1
Sequence:CCGGGTCAGCTTACTGAGAGTTCAACTCGAGTTGAACTCTCAGTAAGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024601.1-268s1c1
Sequence:CCGGGCCTATCAGTCCTTTACTGATCTCGAGATCAGTAAAGGACTGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024601.1-279s1c1
Sequence:CCGGCTTTACTGATACCACAACCAACTCGAGTTGGTTGTGGTATCAGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024601
C1orf227 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 227
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024601.1-148s1c1
Sequence:CCGGCATGGAGTAAGCAAACAACATCTCGAGATGTTGTTTGCTTACTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024601.1-217s1c1
Sequence:CCGGCGAAGCAATCAAGTCAGCTTACTCGAGTAAGCTGACTTGATTGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024601.1-229s1c1
Sequence:CCGGGTCAGCTTACTGAGAGTTCAACTCGAGTTGAACTCTCAGTAAGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024601.1-268s1c1
Sequence:CCGGGCCTATCAGTCCTTTACTGATCTCGAGATCAGTAAAGGACTGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024601.1-279s1c1
Sequence:CCGGCTTTACTGATACCACAACCAACTCGAGTTGGTTGTGGTATCAGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024601
C1orf227 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 227
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024601.1-148s1c1
Sequence:CCGGCATGGAGTAAGCAAACAACATCTCGAGATGTTGTTTGCTTACTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024601.1-217s1c1
Sequence:CCGGCGAAGCAATCAAGTCAGCTTACTCGAGTAAGCTGACTTGATTGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024601.1-229s1c1
Sequence:CCGGGTCAGCTTACTGAGAGTTCAACTCGAGTTGAACTCTCAGTAAGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024601.1-268s1c1
Sequence:CCGGGCCTATCAGTCCTTTACTGATCTCGAGATCAGTAAAGGACTGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024601.1-279s1c1
Sequence:CCGGCTTTACTGATACCACAACCAACTCGAGTTGGTTGTGGTATCAGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks