EMAIL THIS PAGE TO A FRIEND

C1orf228

chromosome 1 open reading frame 228

46 Gene Product Result for
Synonyms: NCRNA00082 p40
Species: Human C1orf228(339541)
UniProtKB ID: Q6PIY5, A1KXE5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004307 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004307 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004307 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001145636 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145636 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145636 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004307 Rosetta Predictions human pricing
XR_039961 Rosetta Predictions human pricing
XR_039962 Rosetta Predictions human pricing
XR_039963 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004307 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229457 predicted 379
2 SASI_Hs01_00229458 predicted 551
3 SASI_Hs01_00229459 predicted 549
4 SASI_Hs01_00229460 predicted 350
5 SASI_Hs01_00229461 predicted 439
6 SASI_Hs01_00229462 predicted 741
7 SASI_Hs01_00229463 predicted 447
8 SASI_Hs01_00229464 predicted 459
9 SASI_Hs01_00229465 predicted 208
10 SASI_Hs01_00229466 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514641 predicted 449
2 SASI_Hs02_00514642 predicted 623
3 SASI_Hs02_00514643 predicted 617
4 SASI_Hs02_00514644 predicted 512
5 SASI_Hs02_00514645 predicted 812
6 SASI_Hs02_00514646 predicted 1419
7 SASI_Hs02_00514647 predicted 1501
8 SASI_Hs02_00514648 predicted 529
9 SASI_Hs02_00514649 predicted 458
10 SASI_Hs02_00514650 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039962 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514651 predicted 449
2 SASI_Hs02_00514652 predicted 629
3 SASI_Hs02_00514653 predicted 614
4 SASI_Hs02_00514654 predicted 511
5 SASI_Hs02_00514655 predicted 806
6 SASI_Hs02_00514656 predicted 1410
7 SASI_Hs02_00514657 predicted 1501
8 SASI_Hs02_00514658 predicted 532
9 SASI_Hs02_00514659 predicted 463
10 SASI_Hs02_00514660 predicted 612
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039963 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514661 predicted 449
2 SASI_Hs02_00514662 predicted 629
3 SASI_Hs02_00514663 predicted 618
4 SASI_Hs02_00514664 predicted 510
5 SASI_Hs02_00514665 predicted 805
6 SASI_Hs02_00514666 predicted 1412
7 SASI_Hs02_00514667 predicted 1503
8 SASI_Hs02_00514668 predicted 533
9 SASI_Hs02_00514669 predicted 456
10 SASI_Hs02_00514670 predicted 612
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004307
C1orf228 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 228
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000172632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004307.1-262s1c1
Sequence:CCGGGAGTCACATCCTCGACAAGTTCTCGAGAACTTGTCGAGGATGTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168648    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004307.1-1743s1c1
Sequence:CCGGGCTGAGGACTTGTACATGAAACTCGAGTTTCATGTACAAGTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004307.1-586s1c1
Sequence:CCGGCAGGACATACAAGGAACTCATCTCGAGATGAGTTCCTTGTATGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004307
C1orf228 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 228
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000172632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004307.1-262s1c1
Sequence:CCGGGAGTCACATCCTCGACAAGTTCTCGAGAACTTGTCGAGGATGTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168648    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004307.1-1743s1c1
Sequence:CCGGGCTGAGGACTTGTACATGAAACTCGAGTTTCATGTACAAGTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004307.1-586s1c1
Sequence:CCGGCAGGACATACAAGGAACTCATCTCGAGATGAGTTCCTTGTATGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004307
C1orf228 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 228
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000172632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004307.1-262s1c1
Sequence:CCGGGAGTCACATCCTCGACAAGTTCTCGAGAACTTGTCGAGGATGTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168648    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004307.1-1743s1c1
Sequence:CCGGGCTGAGGACTTGTACATGAAACTCGAGTTTCATGTACAAGTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004307.1-586s1c1
Sequence:CCGGCAGGACATACAAGGAACTCATCTCGAGATGAGTTCCTTGTATGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145636
C1orf228 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 228
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145636.1-267s21c1
Sequence:CCGGCCTCGACAAGTTCATTGAAACCTCGAGGTTTCAATGAACTTGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145636.1-367s21c1
Sequence:CCGGTCGCTTAGAATCACCTATATGCTCGAGCATATAGGTGATTCTAAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145636.1-433s21c1
Sequence:CCGGTTATCAGCTGTAAGCAGTAATCTCGAGATTACTGCTTACAGCTGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145636.1-727s21c1
Sequence:CCGGCAAGTGTATAAAGGTCTAATACTCGAGTATTAGACCTTTATACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145636.1-584s21c1
Sequence:CCGGGGACATACAAGGAACTCATTTCTCGAGAAATGAGTTCCTTGTATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145636
C1orf228 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 228
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145636.1-267s21c1
Sequence:CCGGCCTCGACAAGTTCATTGAAACCTCGAGGTTTCAATGAACTTGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145636.1-367s21c1
Sequence:CCGGTCGCTTAGAATCACCTATATGCTCGAGCATATAGGTGATTCTAAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145636.1-433s21c1
Sequence:CCGGTTATCAGCTGTAAGCAGTAATCTCGAGATTACTGCTTACAGCTGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145636.1-727s21c1
Sequence:CCGGCAAGTGTATAAAGGTCTAATACTCGAGTATTAGACCTTTATACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145636.1-584s21c1
Sequence:CCGGGGACATACAAGGAACTCATTTCTCGAGAAATGAGTTCCTTGTATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145636
C1orf228 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 228
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145636.1-267s21c1
Sequence:CCGGCCTCGACAAGTTCATTGAAACCTCGAGGTTTCAATGAACTTGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145636.1-367s21c1
Sequence:CCGGTCGCTTAGAATCACCTATATGCTCGAGCATATAGGTGATTCTAAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145636.1-433s21c1
Sequence:CCGGTTATCAGCTGTAAGCAGTAATCTCGAGATTACTGCTTACAGCTGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145636.1-727s21c1
Sequence:CCGGCAAGTGTATAAAGGTCTAATACTCGAGTATTAGACCTTTATACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145636.1-584s21c1
Sequence:CCGGGGACATACAAGGAACTCATTTCTCGAGAAATGAGTTCCTTGTATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks