EMAIL THIS PAGE TO A FRIEND

C1orf229

chromosome 1 open reading frame 229

74 Gene Product Result for
Species: Human C1orf229(388759)
UniProtKB ID: Q6ZS94
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA034756 Anti-C1orf229 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207401 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207401 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207401 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010721 MISSION® esiRNA esiRNA targeting human FLJ45717 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207401 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207401 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018584 predicted 887
2 SASI_Hs01_00018585 predicted 514
3 SASI_Hs02_00374012 predicted 675
4 SASI_Hs01_00018586 predicted 667
5 SASI_Hs01_00018587 predicted 702
6 SASI_Hs01_00018588 predicted 297
7 SASI_Hs01_00018589 predicted 885
8 SASI_Hs01_00018590 predicted 779
9 SASI_Hs01_00018591 predicted 293
10 SASI_Hs01_00018593 predicted 693
11 SASI_Hs01_00018592 predicted 633
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207401
C1orf229 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 229
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207401.1-898s21c1
Sequence:CCGGGCGACTGTAAACCCGAGTCCTCTCGAGAGGACTCGGGTTTACAGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207401.1-306s21c1
Sequence:CCGGGCCTGGCATTCGACTTCTTAGCTCGAGCTAAGAAGTCGAATGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207401.1-1170s21c1
Sequence:CCGGACGCCTGTAATCCCAACCACTCTCGAGAGTGGTTGGGATTACAGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207401.1-1386s21c1
Sequence:CCGGCCCAATTTATTGGTTTACCAGCTCGAGCTGGTAAACCAATAAATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207401.1-1301s21c1
Sequence:CCGGTAGAAAGAGAATCACAGTTTACTCGAGTAAACTGTGATTCTCTTTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172800    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207401.1-1406s1c1
Sequence:CCGGGCTCTTCGTTCTTAGGGCAAACTCGAGTTTGCCCTAAGAACGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168843    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207401.1-1286s1c1
Sequence:CCGGCGCAGACAAAGGATTTAGAAACTCGAGTTTCTAAATCCTTTGTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168645    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207401.1-1674s1c1
Sequence:CCGGGCGTAAAGACATGAAGGCAAACTCGAGTTTGCCTTCATGTCTTTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168771    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207401.1-1777s1c1
Sequence:CCGGGAAACTCTCTTTCCCACATATCTCGAGATATGTGGGAAAGAGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207401
C1orf229 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 229
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207401.1-898s21c1
Sequence:CCGGGCGACTGTAAACCCGAGTCCTCTCGAGAGGACTCGGGTTTACAGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207401.1-306s21c1
Sequence:CCGGGCCTGGCATTCGACTTCTTAGCTCGAGCTAAGAAGTCGAATGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207401.1-1170s21c1
Sequence:CCGGACGCCTGTAATCCCAACCACTCTCGAGAGTGGTTGGGATTACAGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207401.1-1386s21c1
Sequence:CCGGCCCAATTTATTGGTTTACCAGCTCGAGCTGGTAAACCAATAAATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207401.1-1301s21c1
Sequence:CCGGTAGAAAGAGAATCACAGTTTACTCGAGTAAACTGTGATTCTCTTTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172800    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207401.1-1406s1c1
Sequence:CCGGGCTCTTCGTTCTTAGGGCAAACTCGAGTTTGCCCTAAGAACGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168843    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207401.1-1286s1c1
Sequence:CCGGCGCAGACAAAGGATTTAGAAACTCGAGTTTCTAAATCCTTTGTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168645    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207401.1-1674s1c1
Sequence:CCGGGCGTAAAGACATGAAGGCAAACTCGAGTTTGCCTTCATGTCTTTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168771    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207401.1-1777s1c1
Sequence:CCGGGAAACTCTCTTTCCCACATATCTCGAGATATGTGGGAAAGAGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207401
C1orf229 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 229
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207401.1-898s21c1
Sequence:CCGGGCGACTGTAAACCCGAGTCCTCTCGAGAGGACTCGGGTTTACAGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207401.1-306s21c1
Sequence:CCGGGCCTGGCATTCGACTTCTTAGCTCGAGCTAAGAAGTCGAATGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207401.1-1170s21c1
Sequence:CCGGACGCCTGTAATCCCAACCACTCTCGAGAGTGGTTGGGATTACAGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207401.1-1386s21c1
Sequence:CCGGCCCAATTTATTGGTTTACCAGCTCGAGCTGGTAAACCAATAAATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207401.1-1301s21c1
Sequence:CCGGTAGAAAGAGAATCACAGTTTACTCGAGTAAACTGTGATTCTCTTTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172800    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207401.1-1406s1c1
Sequence:CCGGGCTCTTCGTTCTTAGGGCAAACTCGAGTTTGCCCTAAGAACGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168843    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207401.1-1286s1c1
Sequence:CCGGCGCAGACAAAGGATTTAGAAACTCGAGTTTCTAAATCCTTTGTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168645    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207401.1-1674s1c1
Sequence:CCGGGCGTAAAGACATGAAGGCAAACTCGAGTTTGCCTTCATGTCTTTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168771    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207401.1-1777s1c1
Sequence:CCGGGAAACTCTCTTTCCCACATATCTCGAGATATGTGGGAAAGAGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks