EMAIL THIS PAGE TO A FRIEND

C1orf27

chromosome 1 open reading frame 27

73 Gene Product Result for
Synonyms: ODR4 TTG1 odr-4
Gene ID:
Zebrafish(100379182) c1orf27 homolog (H. sapiens)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017847 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017847 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017847 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU003701 MISSION® esiRNA esiRNA targeting human C1orf27 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017847 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104628 predicted 816
2 SASI_Hs01_00104629 predicted 1513
3 SASI_Hs01_00104631 predicted 1517
4 SASI_Hs01_00104632 predicted 1517
5 SASI_Hs01_00104633 predicted 1475
6 SASI_Hs01_00104634 predicted 1492
7 SASI_Hs01_00104635 predicted 1495
8 SASI_Hs01_00104636 predicted 251
9 SASI_Hs01_00104637 predicted 1352
10 SASI_Hs02_00350743 predicted 243
11 SASI_Hs01_00104630 predicted 1544
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017847
VALIDATED
C1orf27 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 27
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017847.2-644s1c1
Sequence:CCGGCTGCTACTTCTGTCAGCTATACTCGAGTATAGCTGACAGAAGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017847.2-1362s1c1
Sequence:CCGGCATAGGTGTGATTGCAGCATTCTCGAGAATGCTGCAATCACACCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_017847.2-1238s1c1
Sequence:CCGGCAGAGGAAACAAACACAGCTTCTCGAGAAGCTGTGTTTGTTTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017847.2-794s1c1
Sequence:CCGGGAGGAAATACTCAAGCAACTACTCGAGTAGTTGCTTGAGTATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017847.2-593s1c1
Sequence:CCGGCATGGCTTTCTTTAGAGTGTACTCGAGTACACTCTAAAGAAAGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017847.2-1378s1c1
Sequence:CCGGGCATTTACAGTTGCAGTCCTTCTCGAGAAGGACTGCAACTGTAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017847.4-700s21c1
Sequence:CCGGCTGCTACTTCTGTCAGCTATACTCGAGTATAGCTGACAGAAGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_017847.4-977s21c1
Sequence:CCGGTGTGAAATGCAGAGCTTATATCTCGAGATATAAGCTCTGCATTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_017847.4-1598s21c1
Sequence:CCGGTGCTGCCATGATGCCTATTTGCTCGAGCAAATAGGCATCATGGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017847.4-850s21c1
Sequence:CCGGGAGGAAATACTCAAGCAACTACTCGAGTAGTTGCTTGAGTATTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_017847.4-1034s21c1
Sequence:CCGGGGCAGTAAAGAGGGATATATTCTCGAGAATATATCCCTCTTTACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017847
VALIDATED
C1orf27 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 27
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017847.2-644s1c1
Sequence:CCGGCTGCTACTTCTGTCAGCTATACTCGAGTATAGCTGACAGAAGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017847.2-1362s1c1
Sequence:CCGGCATAGGTGTGATTGCAGCATTCTCGAGAATGCTGCAATCACACCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_017847.2-1238s1c1
Sequence:CCGGCAGAGGAAACAAACACAGCTTCTCGAGAAGCTGTGTTTGTTTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017847.2-794s1c1
Sequence:CCGGGAGGAAATACTCAAGCAACTACTCGAGTAGTTGCTTGAGTATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017847.2-593s1c1
Sequence:CCGGCATGGCTTTCTTTAGAGTGTACTCGAGTACACTCTAAAGAAAGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017847.2-1378s1c1
Sequence:CCGGGCATTTACAGTTGCAGTCCTTCTCGAGAAGGACTGCAACTGTAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017847.4-700s21c1
Sequence:CCGGCTGCTACTTCTGTCAGCTATACTCGAGTATAGCTGACAGAAGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_017847.4-977s21c1
Sequence:CCGGTGTGAAATGCAGAGCTTATATCTCGAGATATAAGCTCTGCATTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_017847.4-1598s21c1
Sequence:CCGGTGCTGCCATGATGCCTATTTGCTCGAGCAAATAGGCATCATGGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017847.4-850s21c1
Sequence:CCGGGAGGAAATACTCAAGCAACTACTCGAGTAGTTGCTTGAGTATTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_017847.4-1034s21c1
Sequence:CCGGGGCAGTAAAGAGGGATATATTCTCGAGAATATATCCCTCTTTACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017847
VALIDATED
C1orf27 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 27
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017847.2-644s1c1
Sequence:CCGGCTGCTACTTCTGTCAGCTATACTCGAGTATAGCTGACAGAAGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017847.2-1362s1c1
Sequence:CCGGCATAGGTGTGATTGCAGCATTCTCGAGAATGCTGCAATCACACCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_017847.2-1238s1c1
Sequence:CCGGCAGAGGAAACAAACACAGCTTCTCGAGAAGCTGTGTTTGTTTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017847.2-794s1c1
Sequence:CCGGGAGGAAATACTCAAGCAACTACTCGAGTAGTTGCTTGAGTATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017847.2-593s1c1
Sequence:CCGGCATGGCTTTCTTTAGAGTGTACTCGAGTACACTCTAAAGAAAGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017847.2-1378s1c1
Sequence:CCGGGCATTTACAGTTGCAGTCCTTCTCGAGAAGGACTGCAACTGTAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017847.4-700s21c1
Sequence:CCGGCTGCTACTTCTGTCAGCTATACTCGAGTATAGCTGACAGAAGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_017847.4-977s21c1
Sequence:CCGGTGTGAAATGCAGAGCTTATATCTCGAGATATAAGCTCTGCATTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_017847.4-1598s21c1
Sequence:CCGGTGCTGCCATGATGCCTATTTGCTCGAGCAAATAGGCATCATGGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017847.4-850s21c1
Sequence:CCGGGAGGAAATACTCAAGCAACTACTCGAGTAGTTGCTTGAGTATTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_017847.4-1034s21c1
Sequence:CCGGGGCAGTAAAGAGGGATATATTCTCGAGAATATATCCCTCTTTACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks