EMAIL THIS PAGE TO A FRIEND

C1orf35

chromosome 1 open reading frame 35

20 Gene Product Result for
Synonyms: MMTAG2 hMMTAG2
Gene ID:
chicken(769525) chromosome 2 open reading frame, human C1orf35
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024319 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024319 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024319 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024319 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024319 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235901 predicted 1047
2 SASI_Hs01_00235902 predicted 223
3 SASI_Hs01_00235903 predicted 955
4 SASI_Hs01_00235904 predicted 947
5 SASI_Hs01_00235905 predicted 1022
6 SASI_Hs01_00235906 predicted 957
7 SASI_Hs01_00235907 predicted 327
8 SASI_Hs01_00235908 predicted 197
9 SASI_Hs01_00235909 predicted 330
10 SASI_Hs01_00235910 predicted 198
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024319
VALIDATED
C1orf35 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 35
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024319.2-141s21c1
Sequence:CCGGTCAACTGGGAGGACGTGAAGACTCGAGTCTTCACGTCCTCCCAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024319.2-339s21c1
Sequence:CCGGTTGGCTACAAGAACGTGAAGACTCGAGTCTTCACGTTCTTGTAGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024319.2-527s21c1
Sequence:CCGGCTGTCTGTGTTCACGCATCACCTCGAGGTGATGCGTGAACACAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024319.2-1132s21c1
Sequence:CCGGCCAGATTTATCAGTAGAGGCTCTCGAGAGCCTCTACTGATAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024319.2-688s21c1
Sequence:CCGGGAAAGAGAAGAAGAAGAAAGACTCGAGTCTTTCTTCTTCTTCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024319.2-679s1c1
Sequence:CCGGGAAACACAAGAAAGAGAAGAACTCGAGTTCTTCTCTTTCTTGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121942    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024319.2-1132s1c1
Sequence:CCGGCCAGATTTATCAGTAGAGGCTCTCGAGAGCCTCTACTGATAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024319.2-692s1c1
Sequence:CCGGGAGAAGAAGAAGAAAGACAAACTCGAGTTTGTCTTTCTTCTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024319.2-685s1c1
Sequence:CCGGCAAGAAAGAGAAGAAGAAGAACTCGAGTTCTTCTTCTTCTCTTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024319.2-688s1c1
Sequence:CCGGGAAAGAGAAGAAGAAGAAAGACTCGAGTCTTTCTTCTTCTTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024319.2-676s1c1
Sequence:CCGGGAGGAAACACAAGAAAGAGAACTCGAGTTCTCTTTCTTGTGTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024319.2-694s1c1
Sequence:CCGGGAAGAAGAAGAAAGACAAAGACTCGAGTCTTTGTCTTTCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024319
VALIDATED
C1orf35 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 35
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024319.2-141s21c1
Sequence:CCGGTCAACTGGGAGGACGTGAAGACTCGAGTCTTCACGTCCTCCCAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024319.2-339s21c1
Sequence:CCGGTTGGCTACAAGAACGTGAAGACTCGAGTCTTCACGTTCTTGTAGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024319.2-527s21c1
Sequence:CCGGCTGTCTGTGTTCACGCATCACCTCGAGGTGATGCGTGAACACAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024319.2-1132s21c1
Sequence:CCGGCCAGATTTATCAGTAGAGGCTCTCGAGAGCCTCTACTGATAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024319.2-688s21c1
Sequence:CCGGGAAAGAGAAGAAGAAGAAAGACTCGAGTCTTTCTTCTTCTTCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024319.2-679s1c1
Sequence:CCGGGAAACACAAGAAAGAGAAGAACTCGAGTTCTTCTCTTTCTTGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121942    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024319.2-1132s1c1
Sequence:CCGGCCAGATTTATCAGTAGAGGCTCTCGAGAGCCTCTACTGATAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024319.2-692s1c1
Sequence:CCGGGAGAAGAAGAAGAAAGACAAACTCGAGTTTGTCTTTCTTCTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024319.2-685s1c1
Sequence:CCGGCAAGAAAGAGAAGAAGAAGAACTCGAGTTCTTCTTCTTCTCTTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024319.2-688s1c1
Sequence:CCGGGAAAGAGAAGAAGAAGAAAGACTCGAGTCTTTCTTCTTCTTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024319.2-676s1c1
Sequence:CCGGGAGGAAACACAAGAAAGAGAACTCGAGTTCTCTTTCTTGTGTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024319.2-694s1c1
Sequence:CCGGGAAGAAGAAGAAAGACAAAGACTCGAGTCTTTGTCTTTCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024319
VALIDATED
C1orf35 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 35
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024319.2-141s21c1
Sequence:CCGGTCAACTGGGAGGACGTGAAGACTCGAGTCTTCACGTCCTCCCAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024319.2-339s21c1
Sequence:CCGGTTGGCTACAAGAACGTGAAGACTCGAGTCTTCACGTTCTTGTAGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024319.2-527s21c1
Sequence:CCGGCTGTCTGTGTTCACGCATCACCTCGAGGTGATGCGTGAACACAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024319.2-1132s21c1
Sequence:CCGGCCAGATTTATCAGTAGAGGCTCTCGAGAGCCTCTACTGATAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024319.2-688s21c1
Sequence:CCGGGAAAGAGAAGAAGAAGAAAGACTCGAGTCTTTCTTCTTCTTCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024319.2-679s1c1
Sequence:CCGGGAAACACAAGAAAGAGAAGAACTCGAGTTCTTCTCTTTCTTGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121942    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024319.2-1132s1c1
Sequence:CCGGCCAGATTTATCAGTAGAGGCTCTCGAGAGCCTCTACTGATAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024319.2-692s1c1
Sequence:CCGGGAGAAGAAGAAGAAAGACAAACTCGAGTTTGTCTTTCTTCTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024319.2-685s1c1
Sequence:CCGGCAAGAAAGAGAAGAAGAAGAACTCGAGTTCTTCTTCTTCTCTTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024319.2-688s1c1
Sequence:CCGGGAAAGAGAAGAAGAAGAAAGACTCGAGTCTTTCTTCTTCTTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024319.2-676s1c1
Sequence:CCGGGAGGAAACACAAGAAAGAGAACTCGAGTTCTCTTTCTTGTGTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024319.2-694s1c1
Sequence:CCGGGAAGAAGAAGAAAGACAAAGACTCGAGTCTTTGTCTTTCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks