EMAIL THIS PAGE TO A FRIEND

C1orf50

chromosome 1 open reading frame 50

21 Gene Product Result for
UniProtKB ID: Q9BV19
Gene ID:
chicken(419506) chromosome 21 open reading frame, human C1orf50
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024097 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024097 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024097 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU008141 MISSION® esiRNA esiRNA targeting human C1orf50 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024097 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024097 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149434 predicted 412
2 SASI_Hs01_00149435 predicted 311
3 SASI_Hs01_00149436 predicted 724
4 SASI_Hs01_00149438 predicted 373
5 SASI_Hs02_00356576 predicted 744
6 SASI_Hs01_00149439 predicted 765
7 SASI_Hs01_00149440 predicted 653
8 SASI_Hs01_00149442 predicted 350
9 SASI_Hs01_00149443 predicted 532
10 SASI_Hs02_00356577 predicted 642
11 SASI_Hs01_00149437 predicted 727
12 SASI_Hs01_00149441 predicted 530
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024097
VALIDATED
C1orf50 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 50
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167528    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024097.1-868s1c1
Sequence:CCGGGTCAGTCAGTTTCAGAGTATTCTCGAGAATACTCTGAAACTGACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024097.1-441s1c1
Sequence:CCGGCCATCATTTCTCCAAAGGAATCTCGAGATTCCTTTGGAGAAATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024097.1-466s1c1
Sequence:CCGGGACAAGTTGTCCACATGACTTCTCGAGAAGTCATGTGGACAACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024097.2-417s21c1
Sequence:CCGGGCAACATTTACTATCTCTATACTCGAGTATAGAGATAGTAAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024097.2-310s21c1
Sequence:CCGGAGCTGAGCAAATCCAACATTTCTCGAGAAATGTTGGATTTGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024097.2-892s21c1
Sequence:CCGGGTCAGTCAGTTTCAGAGTATTCTCGAGAATACTCTGAAACTGACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_024097.2-380s21c1
Sequence:CCGGCTGCACCATGTAGCTTGTAATCTCGAGATTACAAGCTACATGGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024097
VALIDATED
C1orf50 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 50
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167528    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024097.1-868s1c1
Sequence:CCGGGTCAGTCAGTTTCAGAGTATTCTCGAGAATACTCTGAAACTGACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024097.1-441s1c1
Sequence:CCGGCCATCATTTCTCCAAAGGAATCTCGAGATTCCTTTGGAGAAATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024097.1-466s1c1
Sequence:CCGGGACAAGTTGTCCACATGACTTCTCGAGAAGTCATGTGGACAACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024097.2-417s21c1
Sequence:CCGGGCAACATTTACTATCTCTATACTCGAGTATAGAGATAGTAAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024097.2-310s21c1
Sequence:CCGGAGCTGAGCAAATCCAACATTTCTCGAGAAATGTTGGATTTGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024097.2-892s21c1
Sequence:CCGGGTCAGTCAGTTTCAGAGTATTCTCGAGAATACTCTGAAACTGACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_024097.2-380s21c1
Sequence:CCGGCTGCACCATGTAGCTTGTAATCTCGAGATTACAAGCTACATGGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024097
VALIDATED
C1orf50 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 50
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167528    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024097.1-868s1c1
Sequence:CCGGGTCAGTCAGTTTCAGAGTATTCTCGAGAATACTCTGAAACTGACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024097.1-441s1c1
Sequence:CCGGCCATCATTTCTCCAAAGGAATCTCGAGATTCCTTTGGAGAAATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024097.1-466s1c1
Sequence:CCGGGACAAGTTGTCCACATGACTTCTCGAGAAGTCATGTGGACAACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024097.2-417s21c1
Sequence:CCGGGCAACATTTACTATCTCTATACTCGAGTATAGAGATAGTAAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024097.2-310s21c1
Sequence:CCGGAGCTGAGCAAATCCAACATTTCTCGAGAAATGTTGGATTTGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024097.2-892s21c1
Sequence:CCGGGTCAGTCAGTTTCAGAGTATTCTCGAGAATACTCTGAAACTGACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_024097.2-380s21c1
Sequence:CCGGCTGCACCATGTAGCTTGTAATCTCGAGATTACAAGCTACATGGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks