EMAIL THIS PAGE TO A FRIEND

C1orf51

chromosome 1 open reading frame 51

39 Gene Product Result for
Species: Human C1orf51(148523)
UniProtKB ID: Q8N365, B2RD43, D3DV01, Q8N795, Q96MG6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144697 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144697 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144697 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134581 MISSION® esiRNA esiRNA human C1orf51 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144697 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144697 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171809 predicted 1210
2 SASI_Hs02_00364620 predicted 446
3 SASI_Hs01_00171810 predicted 667
4 SASI_Hs01_00171811 predicted 799
5 SASI_Hs01_00171813 predicted 1276
6 SASI_Hs01_00171814 predicted 793
7 SASI_Hs02_00364621 predicted 1022
8 SASI_Hs01_00171815 predicted 1421
9 SASI_Hs02_00364622 predicted 535
10 SASI_Hs01_00171816 predicted 1278
11 SASI_Hs01_00171812 predicted 458
12 SASI_Hs01_00171817 predicted 1463
13 SASI_Hs01_00171818 predicted 651
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144697
VALIDATED
C1orf51 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 51
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144697.2-1415s21c1
Sequence:CCGGTGGTGAGCCTATGAAACTATCCTCGAGGATAGTTTCATAGGCTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144697.2-1281s21c1
Sequence:CCGGTCCTTTAGCCATGGTCCTTTACTCGAGTAAAGGACCATGGCTAAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144697.2-756s1c1
Sequence:CCGGGAGACCAGTCTAAACACCCAACTCGAGTTGGGTGTTTAGACTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144697.2-815s1c1
Sequence:CCGGGTGTAAAGAACTCCAAGGATTCTCGAGAATCCTTGGAGTTCTTTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144697.2-1067s1c1
Sequence:CCGGGCATCAGCTGACCAAGCATTTCTCGAGAAATGCTTGGTCAGCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144697.2-1459s1c1
Sequence:CCGGGTTTGCCAGTAACTCTGCCATCTCGAGATGGCAGAGTTACTGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144697.2-1421s1c1
Sequence:CCGGGCCTATGAAACTATCTGGAGACTCGAGTCTCCAGATAGTTTCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144697.2-671s1c1
Sequence:CCGGGCATACACCATCTCATCCGAACTCGAGTTCGGATGAGATGGTGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144697
VALIDATED
C1orf51 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 51
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144697.2-1415s21c1
Sequence:CCGGTGGTGAGCCTATGAAACTATCCTCGAGGATAGTTTCATAGGCTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144697.2-1281s21c1
Sequence:CCGGTCCTTTAGCCATGGTCCTTTACTCGAGTAAAGGACCATGGCTAAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144697.2-756s1c1
Sequence:CCGGGAGACCAGTCTAAACACCCAACTCGAGTTGGGTGTTTAGACTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144697.2-815s1c1
Sequence:CCGGGTGTAAAGAACTCCAAGGATTCTCGAGAATCCTTGGAGTTCTTTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144697.2-1067s1c1
Sequence:CCGGGCATCAGCTGACCAAGCATTTCTCGAGAAATGCTTGGTCAGCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144697.2-1459s1c1
Sequence:CCGGGTTTGCCAGTAACTCTGCCATCTCGAGATGGCAGAGTTACTGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144697.2-1421s1c1
Sequence:CCGGGCCTATGAAACTATCTGGAGACTCGAGTCTCCAGATAGTTTCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144697.2-671s1c1
Sequence:CCGGGCATACACCATCTCATCCGAACTCGAGTTCGGATGAGATGGTGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144697
VALIDATED
C1orf51 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 51
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144697.2-1415s21c1
Sequence:CCGGTGGTGAGCCTATGAAACTATCCTCGAGGATAGTTTCATAGGCTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144697.2-1281s21c1
Sequence:CCGGTCCTTTAGCCATGGTCCTTTACTCGAGTAAAGGACCATGGCTAAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144697.2-756s1c1
Sequence:CCGGGAGACCAGTCTAAACACCCAACTCGAGTTGGGTGTTTAGACTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144697.2-815s1c1
Sequence:CCGGGTGTAAAGAACTCCAAGGATTCTCGAGAATCCTTGGAGTTCTTTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144697.2-1067s1c1
Sequence:CCGGGCATCAGCTGACCAAGCATTTCTCGAGAAATGCTTGGTCAGCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144697.2-1459s1c1
Sequence:CCGGGTTTGCCAGTAACTCTGCCATCTCGAGATGGCAGAGTTACTGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144697.2-1421s1c1
Sequence:CCGGGCCTATGAAACTATCTGGAGACTCGAGTCTCCAGATAGTTTCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144697.2-671s1c1
Sequence:CCGGGCATACACCATCTCATCCGAACTCGAGTTCGGATGAGATGGTGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks