EMAIL THIS PAGE TO A FRIEND

C1orf52

chromosome 1 open reading frame 52

56 Gene Product Result for
Synonyms: RP11-234D19.1 gm117
Species: Human C1orf52(148423)
UniProtKB ID: Q8N6N3, B3KX89, Q8TDK5, Q8TDK6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198077 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198077 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198077 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU061311 MISSION® esiRNA esiRNA human C1orf52 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198077 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198077 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026107 predicted 680
2 SASI_Hs01_00026108 predicted 830
3 SASI_Hs01_00026109 predicted 834
4 SASI_Hs01_00026110 predicted 610
5 SASI_Hs01_00026111 predicted 387
6 SASI_Hs01_00026112 predicted 607
7 SASI_Hs01_00026113 predicted 657
8 SASI_Hs01_00026114 predicted 846
9 SASI_Hs02_00371627 predicted 309
10 SASI_Hs02_00371628 predicted 657
11 SASI_Hs01_00026115 predicted 752
12 SASI_Hs01_00026116 predicted 436
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198077
VALIDATED
C1orf52 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 52
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198077.1-393s1c1
Sequence:CCGGGTCTAACATATATGAGGACAACTCGAGTTGTCCTCATATATGTTAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198077.3-1178s21c1
Sequence:CCGGCAACCTAGCGCAAGGTATTATCTCGAGATAATACCTTGCGCTAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198077.3-425s21c1
Sequence:CCGGCTAACATATATGAGGACAATGCTCGAGCATTGTCCTCATATATGTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198077.3-254s21c1
Sequence:CCGGTCTACAATCCGCTCAACAAACCTCGAGGTTTGTTGAGCGGATTGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198077.3-587s21c1
Sequence:CCGGAGAAACAAATGACCAGAATTTCTCGAGAAATTCTGGTCATTTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198077.3-399s21c1
Sequence:CCGGAGAGCTTGACATGGCAATAAACTCGAGTTTATTGCCATGTCAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198077
VALIDATED
C1orf52 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 52
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198077.1-393s1c1
Sequence:CCGGGTCTAACATATATGAGGACAACTCGAGTTGTCCTCATATATGTTAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198077.3-1178s21c1
Sequence:CCGGCAACCTAGCGCAAGGTATTATCTCGAGATAATACCTTGCGCTAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198077.3-425s21c1
Sequence:CCGGCTAACATATATGAGGACAATGCTCGAGCATTGTCCTCATATATGTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198077.3-254s21c1
Sequence:CCGGTCTACAATCCGCTCAACAAACCTCGAGGTTTGTTGAGCGGATTGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198077.3-587s21c1
Sequence:CCGGAGAAACAAATGACCAGAATTTCTCGAGAAATTCTGGTCATTTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198077.3-399s21c1
Sequence:CCGGAGAGCTTGACATGGCAATAAACTCGAGTTTATTGCCATGTCAAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198077
VALIDATED
C1orf52 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 52
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198077.1-393s1c1
Sequence:CCGGGTCTAACATATATGAGGACAACTCGAGTTGTCCTCATATATGTTAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198077.3-1178s21c1
Sequence:CCGGCAACCTAGCGCAAGGTATTATCTCGAGATAATACCTTGCGCTAGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198077.3-425s21c1
Sequence:CCGGCTAACATATATGAGGACAATGCTCGAGCATTGTCCTCATATATGTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198077.3-254s21c1
Sequence:CCGGTCTACAATCCGCTCAACAAACCTCGAGGTTTGTTGAGCGGATTGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198077.3-587s21c1
Sequence:CCGGAGAAACAAATGACCAGAATTTCTCGAGAAATTCTGGTCATTTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198077.3-399s21c1
Sequence:CCGGAGAGCTTGACATGGCAATAAACTCGAGTTTATTGCCATGTCAAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)