EMAIL THIS PAGE TO A FRIEND

C1orf53

chromosome 1 open reading frame 53

28 Gene Product Result for
Species: Human C1orf53(388722)
UniProtKB ID: Q5VUE5, A1L4N2, Q5VUE4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024594 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001024594 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001024594 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU160871 MISSION® esiRNA esiRNA human C1orf53 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024594 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024594 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105685 predicted 311
2 SASI_Hs01_00105686 predicted 255
3 SASI_Hs01_00105688 predicted 348
4 SASI_Hs01_00105689 predicted 221
5 SASI_Hs01_00105690 predicted 363
6 SASI_Hs01_00105691 predicted 262
7 SASI_Hs02_00307174 predicted 273
8 SASI_Hs01_00105692 predicted 298
9 SASI_Hs01_00105693 predicted 309
10 SASI_Hs02_00307175 predicted 263
11 SASI_Hs01_00105684 predicted 264
12 SASI_Hs01_00105687 predicted 304
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024594
VALIDATED
C1orf53 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 53
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001024594.1-358s1c1
Sequence:CCGGGCGTGCAGACATTGTCCATATCTCGAGATATGGACAATGTCTGCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001024594.1-303s1c1
Sequence:CCGGCTATGTGGTGCTCACACAGATCTCGAGATCTGTGTGAGCACCACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001024594.1-326s1c1
Sequence:CCGGCCCACTTGCAAAGAGGTGAATCTCGAGATTCACCTCTTTGCAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001024594.1-272s1c1
Sequence:CCGGGCCAGCTAAACTATGTGGATCCTCGAGGATCCACATAGTTTAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001024594.1-274s1c1
Sequence:CCGGCAGCTAAACTATGTGGATCCACTCGAGTGGATCCACATAGTTTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024594.1-373s1c1
Sequence:CCGGCCATATGGTCAAGTCAATGTTCTCGAGAACATTGACTTGACCATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000185077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001024594.1-374s1c1
Sequence:CCGGCATATGGTCAAGTCAATGTTACTCGAGTAACATTGACTTGACCATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000185164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001024594.1-382s1c1
Sequence:CCGGCAAGTCAATGTTAAAGATCCACTCGAGTGGATCTTTAACATTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001024594.1-385s1c1
Sequence:CCGGGTCAATGTTAAAGATCCATCTCTCGAGAGATGGATCTTTAACATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024594
VALIDATED
C1orf53 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 53
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001024594.1-358s1c1
Sequence:CCGGGCGTGCAGACATTGTCCATATCTCGAGATATGGACAATGTCTGCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001024594.1-303s1c1
Sequence:CCGGCTATGTGGTGCTCACACAGATCTCGAGATCTGTGTGAGCACCACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001024594.1-326s1c1
Sequence:CCGGCCCACTTGCAAAGAGGTGAATCTCGAGATTCACCTCTTTGCAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001024594.1-272s1c1
Sequence:CCGGGCCAGCTAAACTATGTGGATCCTCGAGGATCCACATAGTTTAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001024594.1-274s1c1
Sequence:CCGGCAGCTAAACTATGTGGATCCACTCGAGTGGATCCACATAGTTTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024594.1-373s1c1
Sequence:CCGGCCATATGGTCAAGTCAATGTTCTCGAGAACATTGACTTGACCATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000185077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001024594.1-374s1c1
Sequence:CCGGCATATGGTCAAGTCAATGTTACTCGAGTAACATTGACTTGACCATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000185164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001024594.1-382s1c1
Sequence:CCGGCAAGTCAATGTTAAAGATCCACTCGAGTGGATCTTTAACATTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001024594.1-385s1c1
Sequence:CCGGGTCAATGTTAAAGATCCATCTCTCGAGAGATGGATCTTTAACATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024594
VALIDATED
C1orf53 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 53
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001024594.1-358s1c1
Sequence:CCGGGCGTGCAGACATTGTCCATATCTCGAGATATGGACAATGTCTGCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001024594.1-303s1c1
Sequence:CCGGCTATGTGGTGCTCACACAGATCTCGAGATCTGTGTGAGCACCACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001024594.1-326s1c1
Sequence:CCGGCCCACTTGCAAAGAGGTGAATCTCGAGATTCACCTCTTTGCAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001024594.1-272s1c1
Sequence:CCGGGCCAGCTAAACTATGTGGATCCTCGAGGATCCACATAGTTTAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001024594.1-274s1c1
Sequence:CCGGCAGCTAAACTATGTGGATCCACTCGAGTGGATCCACATAGTTTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024594.1-373s1c1
Sequence:CCGGCCATATGGTCAAGTCAATGTTCTCGAGAACATTGACTTGACCATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000185077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001024594.1-374s1c1
Sequence:CCGGCATATGGTCAAGTCAATGTTACTCGAGTAACATTGACTTGACCATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000185164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001024594.1-382s1c1
Sequence:CCGGCAAGTCAATGTTAAAGATCCACTCGAGTGGATCTTTAACATTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001024594.1-385s1c1
Sequence:CCGGGTCAATGTTAAAGATCCATCTCTCGAGAGATGGATCTTTAACATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks