EMAIL THIS PAGE TO A FRIEND

C1orf54

chromosome 1 open reading frame 54

20 Gene Product Result for
Species: Human C1orf54(79630)
UniProtKB ID: Q8WWF1, Q9H5P3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024579 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024579 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024579 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056191 MISSION® esiRNA esiRNA human C1orf54 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024579 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024579 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237236 predicted 234
2 SASI_Hs01_00237237 predicted 204
3 SASI_Hs01_00237238 predicted 241
4 SASI_Hs01_00237239 predicted 237
5 SASI_Hs01_00237241 predicted 261
6 SASI_Hs01_00237242 predicted 216
7 SASI_Hs01_00237243 predicted 244
8 SASI_Hs01_00237244 predicted 236
9 SASI_Hs02_00356902 predicted 237
10 SASI_Hs01_00237245 predicted 238
11 SASI_Hs01_00237240 predicted 226
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024579
VALIDATED
C1orf54 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 54
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024579.1-290s1c1
Sequence:CCGGGCCTGTAACTGTGAAACCAGTCTCGAGACTGGTTTCACAGTTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024579.1-58s1c1
Sequence:CCGGCACTTATCCTGGGACAAGAATCTCGAGATTCTTGTCCCAGGATAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024579.1-108s1c1
Sequence:CCGGGAATATTATCAGGTGGTCTATCTCGAGATAGACCACCTGATAATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024579.2-305s21c1
Sequence:CCGGACCAGTAACAACGGAACCTAGCTCGAGCTAGGTTCCGTTGTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024579.2-239s21c1
Sequence:CCGGAGCAATAGAGACTACCATTAGCTCGAGCTAATGGTAGTCTCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024579.2-152s21c1
Sequence:CCGGTGATGACTTTAGTGCAGATTTCTCGAGAAATCTGCACTAAAGTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024579.2-214s21c1
Sequence:CCGGACAGGTTGGATAAGGACATAACTCGAGTTATGTCCTTATCCAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024579.2-174s21c1
Sequence:CCGGACCATTGATTACTCCATATTTCTCGAGAAATATGGAGTAATCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024579.2-111s21c1
Sequence:CCGGTATTATCAGGTGGTCTATTATCTCGAGATAATAGACCACCTGATAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024579.2-59s21c1
Sequence:CCGGACTTATCCTGGGACAAGAATACTCGAGTATTCTTGTCCCAGGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024579.2-278s21c1
Sequence:CCGGAGACCATCCGAAGCCTGTAACCTCGAGGTTACAGGCTTCGGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024579
VALIDATED
C1orf54 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 54
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024579.1-290s1c1
Sequence:CCGGGCCTGTAACTGTGAAACCAGTCTCGAGACTGGTTTCACAGTTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024579.1-58s1c1
Sequence:CCGGCACTTATCCTGGGACAAGAATCTCGAGATTCTTGTCCCAGGATAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024579.1-108s1c1
Sequence:CCGGGAATATTATCAGGTGGTCTATCTCGAGATAGACCACCTGATAATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024579.2-305s21c1
Sequence:CCGGACCAGTAACAACGGAACCTAGCTCGAGCTAGGTTCCGTTGTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024579.2-239s21c1
Sequence:CCGGAGCAATAGAGACTACCATTAGCTCGAGCTAATGGTAGTCTCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024579.2-152s21c1
Sequence:CCGGTGATGACTTTAGTGCAGATTTCTCGAGAAATCTGCACTAAAGTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024579.2-214s21c1
Sequence:CCGGACAGGTTGGATAAGGACATAACTCGAGTTATGTCCTTATCCAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024579.2-174s21c1
Sequence:CCGGACCATTGATTACTCCATATTTCTCGAGAAATATGGAGTAATCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024579.2-111s21c1
Sequence:CCGGTATTATCAGGTGGTCTATTATCTCGAGATAATAGACCACCTGATAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024579.2-59s21c1
Sequence:CCGGACTTATCCTGGGACAAGAATACTCGAGTATTCTTGTCCCAGGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024579.2-278s21c1
Sequence:CCGGAGACCATCCGAAGCCTGTAACCTCGAGGTTACAGGCTTCGGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024579
VALIDATED
C1orf54 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 54
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024579.1-290s1c1
Sequence:CCGGGCCTGTAACTGTGAAACCAGTCTCGAGACTGGTTTCACAGTTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024579.1-58s1c1
Sequence:CCGGCACTTATCCTGGGACAAGAATCTCGAGATTCTTGTCCCAGGATAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024579.1-108s1c1
Sequence:CCGGGAATATTATCAGGTGGTCTATCTCGAGATAGACCACCTGATAATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024579.2-305s21c1
Sequence:CCGGACCAGTAACAACGGAACCTAGCTCGAGCTAGGTTCCGTTGTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024579.2-239s21c1
Sequence:CCGGAGCAATAGAGACTACCATTAGCTCGAGCTAATGGTAGTCTCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024579.2-152s21c1
Sequence:CCGGTGATGACTTTAGTGCAGATTTCTCGAGAAATCTGCACTAAAGTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024579.2-214s21c1
Sequence:CCGGACAGGTTGGATAAGGACATAACTCGAGTTATGTCCTTATCCAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024579.2-174s21c1
Sequence:CCGGACCATTGATTACTCCATATTTCTCGAGAAATATGGAGTAATCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024579.2-111s21c1
Sequence:CCGGTATTATCAGGTGGTCTATTATCTCGAGATAATAGACCACCTGATAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024579.2-59s21c1
Sequence:CCGGACTTATCCTGGGACAAGAATACTCGAGTATTCTTGTCCCAGGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024579.2-278s21c1
Sequence:CCGGAGACCATCCGAAGCCTGTAACCTCGAGGTTACAGGCTTCGGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks