EMAIL THIS PAGE TO A FRIEND

C1orf56

chromosome 1 open reading frame 56

41 Gene Product Result for
Synonyms: MENT RP11-316M1.9
Species: Human C1orf56(54964)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017860 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017860 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017860 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017860 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017860 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121727 predicted 1265
2 SASI_Hs01_00121728 predicted 1066
3 SASI_Hs01_00121729 predicted 1075
4 SASI_Hs01_00121730 predicted 1196
5 SASI_Hs01_00121731 predicted 498
6 SASI_Hs01_00121732 predicted 483
7 SASI_Hs01_00121733 predicted 1059
8 SASI_Hs01_00121735 predicted 1087
9 SASI_Hs02_00350775 predicted 502
10 SASI_Hs01_00121736 predicted 1539
11 SASI_Hs01_00121734 predicted 1029
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017860
VALIDATED
C1orf56 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 56
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017860.3-436s21c1
Sequence:CCGGTTCCCAGTGCGACTCCCAATACTCGAGTATTGGGAGTCGCACTGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017860.3-1084s21c1
Sequence:CCGGAGAGGTAATGGCCACTTCATCCTCGAGGATGAAGTGGCCATTACCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017860.3-397s21c1
Sequence:CCGGTTGTGATTAATGCCGGAAAGGCTCGAGCCTTTCCGGCATTAATCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017860.3-1235s21c1
Sequence:CCGGTGAGGGAGGAGAGACATAAATCTCGAGATTTATGTCTCTCCTCCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_017860.3-1018s1c1
Sequence:CCGGGCCTGGAGGATATTTGGAATACTCGAGTATTCCAAATATCCTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005647    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017860.3-1264s1c1
Sequence:CCGGCCCTAAGACTGAACTATGTAACTCGAGTTACATAGTTCAGTCTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017860.3-812s1c1
Sequence:CCGGCTATCAACAATGTCCCTGCAACTCGAGTTGCAGGGACATTGTTGATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_017860.3-472s1c1
Sequence:CCGGGCACGAGGTTTATAGCCAATACTCGAGTATTGGCTATAAACCTCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_017860.3-237s1c1
Sequence:CCGGCGGAAGACAAGGATAATCCTACTCGAGTAGGATTATCCTTGTCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017860
VALIDATED
C1orf56 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 56
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017860.3-436s21c1
Sequence:CCGGTTCCCAGTGCGACTCCCAATACTCGAGTATTGGGAGTCGCACTGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017860.3-1084s21c1
Sequence:CCGGAGAGGTAATGGCCACTTCATCCTCGAGGATGAAGTGGCCATTACCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017860.3-397s21c1
Sequence:CCGGTTGTGATTAATGCCGGAAAGGCTCGAGCCTTTCCGGCATTAATCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017860.3-1235s21c1
Sequence:CCGGTGAGGGAGGAGAGACATAAATCTCGAGATTTATGTCTCTCCTCCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_017860.3-1018s1c1
Sequence:CCGGGCCTGGAGGATATTTGGAATACTCGAGTATTCCAAATATCCTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005647    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017860.3-1264s1c1
Sequence:CCGGCCCTAAGACTGAACTATGTAACTCGAGTTACATAGTTCAGTCTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017860.3-812s1c1
Sequence:CCGGCTATCAACAATGTCCCTGCAACTCGAGTTGCAGGGACATTGTTGATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_017860.3-472s1c1
Sequence:CCGGGCACGAGGTTTATAGCCAATACTCGAGTATTGGCTATAAACCTCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_017860.3-237s1c1
Sequence:CCGGCGGAAGACAAGGATAATCCTACTCGAGTAGGATTATCCTTGTCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017860
VALIDATED
C1orf56 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 56
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017860.3-436s21c1
Sequence:CCGGTTCCCAGTGCGACTCCCAATACTCGAGTATTGGGAGTCGCACTGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017860.3-1084s21c1
Sequence:CCGGAGAGGTAATGGCCACTTCATCCTCGAGGATGAAGTGGCCATTACCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017860.3-397s21c1
Sequence:CCGGTTGTGATTAATGCCGGAAAGGCTCGAGCCTTTCCGGCATTAATCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017860.3-1235s21c1
Sequence:CCGGTGAGGGAGGAGAGACATAAATCTCGAGATTTATGTCTCTCCTCCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_017860.3-1018s1c1
Sequence:CCGGGCCTGGAGGATATTTGGAATACTCGAGTATTCCAAATATCCTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005647    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017860.3-1264s1c1
Sequence:CCGGCCCTAAGACTGAACTATGTAACTCGAGTTACATAGTTCAGTCTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017860.3-812s1c1
Sequence:CCGGCTATCAACAATGTCCCTGCAACTCGAGTTGCAGGGACATTGTTGATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_017860.3-472s1c1
Sequence:CCGGGCACGAGGTTTATAGCCAATACTCGAGTATTGGCTATAAACCTCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_017860.3-237s1c1
Sequence:CCGGCGGAAGACAAGGATAATCCTACTCGAGTAGGATTATCCTTGTCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks