EMAIL THIS PAGE TO A FRIEND

C1orf61

chromosome 1 open reading frame 61

18 Gene Product Result for
Synonyms: CROC4
Species: Human C1orf61(10485)
UniProtKB ID: Q13536, B1ALL5, B1ALL8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006365 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006365 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006365 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006365 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006365 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195573 predicted 519
2 SASI_Hs02_00341426 predicted 399
3 SASI_Hs01_00195574 predicted 304
4 SASI_Hs01_00195576 predicted 617
5 SASI_Hs01_00195577 predicted 476
6 SASI_Hs01_00195578 predicted 621
7 SASI_Hs01_00195579 predicted 636
8 SASI_Hs01_00195580 predicted 419
9 SASI_Hs01_00195581 predicted 612
10 SASI_Hs01_00195582 predicted 564
11 SASI_Hs01_00195575 predicted 599
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006365
C1orf61 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 61
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006365.1-312s1c1
Sequence:CCGGCAGCACAAGCCATTGTGGAATCTCGAGATTCCACAATGGCTTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167021    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006365.1-624s1c1
Sequence:CCGGCTCTAGCAAGTTGAAGTCAAACTCGAGTTTGACTTCAACTTGCTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006365.1-625s21c1
Sequence:CCGGTCTAGCAAGTTGAAGTCAAACCTCGAGGTTTGACTTCAACTTGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006365.1-468s21c1
Sequence:CCGGCATGTCTAACCAAGATCTATACTCGAGTATAGATCTTGGTTAGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006365.1-426s21c1
Sequence:CCGGATTCCATGATCTTGCTTATTCCTCGAGGAATAAGCAAGATCATGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006365.1-571s21c1
Sequence:CCGGGGGCTGGATTCCCTCTGATAACTCGAGTTATCAGAGGGAATCCAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006365.1-490s21c1
Sequence:CCGGGGCTATAGCACCAGCTCTTTGCTCGAGCAAAGAGCTGGTGCTATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006365
C1orf61 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 61
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006365.1-312s1c1
Sequence:CCGGCAGCACAAGCCATTGTGGAATCTCGAGATTCCACAATGGCTTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167021    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006365.1-624s1c1
Sequence:CCGGCTCTAGCAAGTTGAAGTCAAACTCGAGTTTGACTTCAACTTGCTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006365.1-625s21c1
Sequence:CCGGTCTAGCAAGTTGAAGTCAAACCTCGAGGTTTGACTTCAACTTGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006365.1-468s21c1
Sequence:CCGGCATGTCTAACCAAGATCTATACTCGAGTATAGATCTTGGTTAGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006365.1-426s21c1
Sequence:CCGGATTCCATGATCTTGCTTATTCCTCGAGGAATAAGCAAGATCATGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006365.1-571s21c1
Sequence:CCGGGGGCTGGATTCCCTCTGATAACTCGAGTTATCAGAGGGAATCCAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006365.1-490s21c1
Sequence:CCGGGGCTATAGCACCAGCTCTTTGCTCGAGCAAAGAGCTGGTGCTATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006365
C1orf61 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 61
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006365.1-312s1c1
Sequence:CCGGCAGCACAAGCCATTGTGGAATCTCGAGATTCCACAATGGCTTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167021    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006365.1-624s1c1
Sequence:CCGGCTCTAGCAAGTTGAAGTCAAACTCGAGTTTGACTTCAACTTGCTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006365.1-625s21c1
Sequence:CCGGTCTAGCAAGTTGAAGTCAAACCTCGAGGTTTGACTTCAACTTGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006365.1-468s21c1
Sequence:CCGGCATGTCTAACCAAGATCTATACTCGAGTATAGATCTTGGTTAGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006365.1-426s21c1
Sequence:CCGGATTCCATGATCTTGCTTATTCCTCGAGGAATAAGCAAGATCATGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006365.1-571s21c1
Sequence:CCGGGGGCTGGATTCCCTCTGATAACTCGAGTTATCAGAGGGAATCCAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006365.1-490s21c1
Sequence:CCGGGGCTATAGCACCAGCTCTTTGCTCGAGCAAAGAGCTGGTGCTATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks