EMAIL THIS PAGE TO A FRIEND

C1orf63

chromosome 1 open reading frame 63

57 Gene Product Result for
Synonyms: DJ465N24.2.1 NPD014 RP3-465N24.4
Species: Human C1orf63(57035)
UniProtKB ID: Q9BUV0, A8K917, Q49AA4, Q5TH71, Q9GZP6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020317 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020317 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020317 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086661 MISSION® esiRNA esiRNA human C1orf63 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020317 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020317 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230018 predicted 798
2 SASI_Hs01_00230019 predicted 250
3 SASI_Hs01_00230020 predicted 1135
4 SASI_Hs01_00230021 predicted 693
5 SASI_Hs01_00230022 predicted 540
6 SASI_Hs01_00230023 predicted 885
7 SASI_Hs01_00230025 predicted 940
8 SASI_Hs02_00353234 predicted 666
9 SASI_Hs01_00230026 predicted 826
10 SASI_Hs01_00230027 predicted 810
11 SASI_Hs01_00230024 predicted 842
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020317
C1orf63 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 63
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163784    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020317.3-1313s1c1
Sequence:CCGGGCACAGATGGACCAAAGGTTACTCGAGTAACCTTTGGTCCATCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020317.3-881s1c1
Sequence:CCGGCAAGCCGTGGAATAGGTGTATCTCGAGATACACCTATTCCACGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020317.3-817s1c1
Sequence:CCGGGCTCTAGGAACAACCAACATTCTCGAGAATGTTGGTTGTTCCTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159974    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020317.3-1292s1c1
Sequence:CCGGCTCTTGCAGATATGAGAGATACTCGAGTATCTCTCATATCTGCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020317.3-1001s1c1
Sequence:CCGGGCTCTAATAATTCTGTAGCAACTCGAGTTGCTACAGAATTATTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020317.3-1138s1c1
Sequence:CCGGGATGGCTAAGTTTGCATGAAACTCGAGTTTCATGCAAACTTAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020317.3-775s1c1
Sequence:CCGGCGAATGGAGCTGTTAGAAATACTCGAGTATTTCTAACAGCTCCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160766    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020317.3-1186s1c1
Sequence:CCGGCTAGCATTATCCCATCCCTTTCTCGAGAAAGGGATGGGATAATGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020317.3-978s1c1
Sequence:CCGGCCAGCAAAGAAGCATAGCTTTCTCGAGAAAGCTATGCTTCTTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020317.3-884s1c1
Sequence:CCGGGCCGTGGAATAGGTGTATCAACTCGAGTTGATACACCTATTCCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020317.3-1300s1c1
Sequence:CCGGGATATGAGAGATAGCACAGATCTCGAGATCTGTGCTATCTCTCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020317.3-844s1c1
Sequence:CCGGCCAGCTAGTCTCAGAACTGTTCTCGAGAACAGTTCTGAGACTAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020317
C1orf63 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 63
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163784    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020317.3-1313s1c1
Sequence:CCGGGCACAGATGGACCAAAGGTTACTCGAGTAACCTTTGGTCCATCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020317.3-881s1c1
Sequence:CCGGCAAGCCGTGGAATAGGTGTATCTCGAGATACACCTATTCCACGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020317.3-817s1c1
Sequence:CCGGGCTCTAGGAACAACCAACATTCTCGAGAATGTTGGTTGTTCCTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159974    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020317.3-1292s1c1
Sequence:CCGGCTCTTGCAGATATGAGAGATACTCGAGTATCTCTCATATCTGCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020317.3-1001s1c1
Sequence:CCGGGCTCTAATAATTCTGTAGCAACTCGAGTTGCTACAGAATTATTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020317.3-1138s1c1
Sequence:CCGGGATGGCTAAGTTTGCATGAAACTCGAGTTTCATGCAAACTTAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020317.3-775s1c1
Sequence:CCGGCGAATGGAGCTGTTAGAAATACTCGAGTATTTCTAACAGCTCCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160766    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020317.3-1186s1c1
Sequence:CCGGCTAGCATTATCCCATCCCTTTCTCGAGAAAGGGATGGGATAATGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020317.3-978s1c1
Sequence:CCGGCCAGCAAAGAAGCATAGCTTTCTCGAGAAAGCTATGCTTCTTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020317.3-884s1c1
Sequence:CCGGGCCGTGGAATAGGTGTATCAACTCGAGTTGATACACCTATTCCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020317.3-1300s1c1
Sequence:CCGGGATATGAGAGATAGCACAGATCTCGAGATCTGTGCTATCTCTCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020317.3-844s1c1
Sequence:CCGGCCAGCTAGTCTCAGAACTGTTCTCGAGAACAGTTCTGAGACTAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020317
C1orf63 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 63
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163784    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020317.3-1313s1c1
Sequence:CCGGGCACAGATGGACCAAAGGTTACTCGAGTAACCTTTGGTCCATCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020317.3-881s1c1
Sequence:CCGGCAAGCCGTGGAATAGGTGTATCTCGAGATACACCTATTCCACGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020317.3-817s1c1
Sequence:CCGGGCTCTAGGAACAACCAACATTCTCGAGAATGTTGGTTGTTCCTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159974    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020317.3-1292s1c1
Sequence:CCGGCTCTTGCAGATATGAGAGATACTCGAGTATCTCTCATATCTGCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020317.3-1001s1c1
Sequence:CCGGGCTCTAATAATTCTGTAGCAACTCGAGTTGCTACAGAATTATTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020317.3-1138s1c1
Sequence:CCGGGATGGCTAAGTTTGCATGAAACTCGAGTTTCATGCAAACTTAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020317.3-775s1c1
Sequence:CCGGCGAATGGAGCTGTTAGAAATACTCGAGTATTTCTAACAGCTCCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160766    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020317.3-1186s1c1
Sequence:CCGGCTAGCATTATCCCATCCCTTTCTCGAGAAAGGGATGGGATAATGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020317.3-978s1c1
Sequence:CCGGCCAGCAAAGAAGCATAGCTTTCTCGAGAAAGCTATGCTTCTTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020317.3-884s1c1
Sequence:CCGGGCCGTGGAATAGGTGTATCAACTCGAGTTGATACACCTATTCCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020317.3-1300s1c1
Sequence:CCGGGATATGAGAGATAGCACAGATCTCGAGATCTGTGCTATCTCTCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020317.3-844s1c1
Sequence:CCGGCCAGCTAGTCTCAGAACTGTTCTCGAGAACAGTTCTGAGACTAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks