EMAIL THIS PAGE TO A FRIEND

C1orf64

chromosome 1 open reading frame 64

30 Gene Product Result for
Synonyms: ERRF RP11-5P18.4
Species: Human C1orf64(149563)
UniProtKB ID: Q8NEQ6, B3KXI9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178840 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178840 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178840 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU154151 MISSION® esiRNA esiRNA human C1orf64 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178840 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178840 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225274 predicted 485
2 SASI_Hs01_00225275 predicted 491
3 SASI_Hs01_00225276 predicted 488
4 SASI_Hs01_00225277 predicted 528
5 SASI_Hs01_00225278 predicted 487
6 SASI_Hs01_00225279 predicted 301
7 SASI_Hs01_00225280 predicted 264
8 SASI_Hs02_00369891 predicted 453
9 SASI_Hs01_00225282 predicted 404
10 SASI_Hs01_00225283 predicted 291
11 SASI_Hs01_00225281 predicted 501
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178840
C1orf64 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 64
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166750    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178840.2-729s1c1
Sequence:CCGGCAGGATAAGTCACCTGCACATCTCGAGATGTGCAGGTGACTTATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178840.2-520s1c1
Sequence:CCGGGAACAGTCAAGGACTCACTGACTCGAGTCAGTGAGTCCTTGACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178840.2-302s1c1
Sequence:CCGGGAAGACTTACATCGTGTTCTGCTCGAGCAGAACACGATGTAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159284    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178840.2-750s1c1
Sequence:CCGGGAAGAGACTCATTCATTCATACTCGAGTATGAATGAATGAGTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159584    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178840.2-771s1c1
Sequence:CCGGCAGCAAATATTACTGGTACATCTCGAGATGTACCAGTAATATTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160279    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178840.2-757s1c1
Sequence:CCGGCTCATTCATTCATACAGCAAACTCGAGTTTGCTGTATGAATGAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161298    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178840.2-674s1c1
Sequence:CCGGGAAACATCATTAGATCCGCTACTCGAGTAGCGGATCTAATGATGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161486    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178840.2-668s1c1
Sequence:CCGGGCCAAGGAAACATCATTAGATCTCGAGATCTAATGATGTTTCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162683    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178840.2-745s1c1
Sequence:CCGGCACATGAAGAGACTCATTCATCTCGAGATGAATGAGTCTCTTCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163295    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178840.2-744s1c1
Sequence:CCGGGCACATGAAGAGACTCATTCACTCGAGTGAATGAGTCTCTTCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178840.2-741s1c1
Sequence:CCGGCCTGCACATGAAGAGACTCATCTCGAGATGAGTCTCTTCATGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178840
C1orf64 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 64
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166750    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178840.2-729s1c1
Sequence:CCGGCAGGATAAGTCACCTGCACATCTCGAGATGTGCAGGTGACTTATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178840.2-520s1c1
Sequence:CCGGGAACAGTCAAGGACTCACTGACTCGAGTCAGTGAGTCCTTGACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178840.2-302s1c1
Sequence:CCGGGAAGACTTACATCGTGTTCTGCTCGAGCAGAACACGATGTAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159284    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178840.2-750s1c1
Sequence:CCGGGAAGAGACTCATTCATTCATACTCGAGTATGAATGAATGAGTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159584    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178840.2-771s1c1
Sequence:CCGGCAGCAAATATTACTGGTACATCTCGAGATGTACCAGTAATATTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160279    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178840.2-757s1c1
Sequence:CCGGCTCATTCATTCATACAGCAAACTCGAGTTTGCTGTATGAATGAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161298    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178840.2-674s1c1
Sequence:CCGGGAAACATCATTAGATCCGCTACTCGAGTAGCGGATCTAATGATGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161486    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178840.2-668s1c1
Sequence:CCGGGCCAAGGAAACATCATTAGATCTCGAGATCTAATGATGTTTCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162683    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178840.2-745s1c1
Sequence:CCGGCACATGAAGAGACTCATTCATCTCGAGATGAATGAGTCTCTTCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163295    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178840.2-744s1c1
Sequence:CCGGGCACATGAAGAGACTCATTCACTCGAGTGAATGAGTCTCTTCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178840.2-741s1c1
Sequence:CCGGCCTGCACATGAAGAGACTCATCTCGAGATGAGTCTCTTCATGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178840
C1orf64 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 64
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166750    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178840.2-729s1c1
Sequence:CCGGCAGGATAAGTCACCTGCACATCTCGAGATGTGCAGGTGACTTATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178840.2-520s1c1
Sequence:CCGGGAACAGTCAAGGACTCACTGACTCGAGTCAGTGAGTCCTTGACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178840.2-302s1c1
Sequence:CCGGGAAGACTTACATCGTGTTCTGCTCGAGCAGAACACGATGTAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159284    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178840.2-750s1c1
Sequence:CCGGGAAGAGACTCATTCATTCATACTCGAGTATGAATGAATGAGTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159584    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178840.2-771s1c1
Sequence:CCGGCAGCAAATATTACTGGTACATCTCGAGATGTACCAGTAATATTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160279    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178840.2-757s1c1
Sequence:CCGGCTCATTCATTCATACAGCAAACTCGAGTTTGCTGTATGAATGAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161298    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178840.2-674s1c1
Sequence:CCGGGAAACATCATTAGATCCGCTACTCGAGTAGCGGATCTAATGATGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161486    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178840.2-668s1c1
Sequence:CCGGGCCAAGGAAACATCATTAGATCTCGAGATCTAATGATGTTTCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162683    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178840.2-745s1c1
Sequence:CCGGCACATGAAGAGACTCATTCATCTCGAGATGAATGAGTCTCTTCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163295    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178840.2-744s1c1
Sequence:CCGGGCACATGAAGAGACTCATTCACTCGAGTGAATGAGTCTCTTCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178840.2-741s1c1
Sequence:CCGGCCTGCACATGAAGAGACTCATCTCGAGATGAGTCTCTTCATGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks