EMAIL THIS PAGE TO A FRIEND

C1orf65

chromosome 1 open reading frame 65

20 Gene Product Result for
Synonyms: RP11-76K24.1
Species: Human C1orf65(164127)
UniProtKB ID: Q8N715, Q8N746, Q8NA93
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152610 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152610 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152610 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149941 MISSION® esiRNA esiRNA human C1orf65 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152610 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152610 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159660 predicted 1672
2 SASI_Hs01_00159661 predicted 1778
3 SASI_Hs01_00159662 predicted 698
4 SASI_Hs01_00159663 predicted 1313
5 SASI_Hs01_00159664 predicted 903
6 SASI_Hs01_00159666 predicted 621
7 SASI_Hs01_00159667 predicted 1784
8 SASI_Hs01_00159668 predicted 888
9 SASI_Hs01_00159669 predicted 1287
10 SASI_Hs02_00366461 predicted 447
11 SASI_Hs01_00159665 predicted 1584
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152610
C1orf65 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 65
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152610.1-1728s21c1
Sequence:CCGGGGCATCAAGGAGGCCATTAAGCTCGAGCTTAATGGCCTCCTTGATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152610.1-693s21c1
Sequence:CCGGAGCGACCAGGTTGAGTCATTACTCGAGTAATGACTCAACCTGGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152610.1-1263s21c1
Sequence:CCGGTGTCGCAAGAGGCACCTACATCTCGAGATGTAGGTGCCTCTTGCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152610.1-1756s21c1
Sequence:CCGGAGCAGAGGGTGCAGCACATTTCTCGAGAAATGTGCTGCACCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152610.1-1318s21c1
Sequence:CCGGACCTGAGCTCCCTCATCAATTCTCGAGAATTGATGAGGGAGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152610
C1orf65 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 65
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152610.1-1728s21c1
Sequence:CCGGGGCATCAAGGAGGCCATTAAGCTCGAGCTTAATGGCCTCCTTGATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152610.1-693s21c1
Sequence:CCGGAGCGACCAGGTTGAGTCATTACTCGAGTAATGACTCAACCTGGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152610.1-1263s21c1
Sequence:CCGGTGTCGCAAGAGGCACCTACATCTCGAGATGTAGGTGCCTCTTGCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152610.1-1756s21c1
Sequence:CCGGAGCAGAGGGTGCAGCACATTTCTCGAGAAATGTGCTGCACCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152610.1-1318s21c1
Sequence:CCGGACCTGAGCTCCCTCATCAATTCTCGAGAATTGATGAGGGAGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152610
C1orf65 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 65
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152610.1-1728s21c1
Sequence:CCGGGGCATCAAGGAGGCCATTAAGCTCGAGCTTAATGGCCTCCTTGATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152610.1-693s21c1
Sequence:CCGGAGCGACCAGGTTGAGTCATTACTCGAGTAATGACTCAACCTGGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152610.1-1263s21c1
Sequence:CCGGTGTCGCAAGAGGCACCTACATCTCGAGATGTAGGTGCCTCTTGCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152610.1-1756s21c1
Sequence:CCGGAGCAGAGGGTGCAGCACATTTCTCGAGAAATGTGCTGCACCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152610.1-1318s21c1
Sequence:CCGGACCTGAGCTCCCTCATCAATTCTCGAGAATTGATGAGGGAGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks