EMAIL THIS PAGE TO A FRIEND

C1orf68

chromosome 1 open reading frame 68

15 Gene Product Result for
Synonyms: LEP7 XP32
Species: Human C1orf68(100129271)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024679 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001024679 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001024679 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001721554 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721554 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00443542 predicted 237
2 SASI_Hs02_00443543 predicted 222
3 SASI_Hs02_00443544 predicted 235
4 SASI_Hs02_00443545 predicted 339
5 SASI_Hs02_00443546 predicted 226
6 SASI_Hs02_00443547 predicted 302
7 SASI_Hs02_00443548 predicted 396
8 SASI_Hs02_00443549 predicted 409
9 SASI_Hs02_00443550 predicted 418
10 SASI_Hs02_00443551 predicted 445
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024679
C1orf68 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 68
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024679.2-221s21c1
Sequence:CCGGGCCAGAGGACCTATGTGAAATCTCGAGATTTCACATAGGTCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024679.2-674s21c1
Sequence:CCGGGGTGCTGCTGTTTGGGAATTACTCGAGTAATTCCCAAACAGCAGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024679.2-413s21c1
Sequence:CCGGCTCCTTGCCAGAGCTATTATGCTCGAGCATAATAGCTCTGGCAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024679.2-141s21c1
Sequence:CCGGTGCTCCATGCCCTACTCAAACCTCGAGGTTTGAGTAGGGCATGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024679.2-282s21c1
Sequence:CCGGCTGCCAGACAACCTATGTAAACTCGAGTTTACATAGGTTGTCTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024679
C1orf68 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 68
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024679.2-221s21c1
Sequence:CCGGGCCAGAGGACCTATGTGAAATCTCGAGATTTCACATAGGTCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024679.2-674s21c1
Sequence:CCGGGGTGCTGCTGTTTGGGAATTACTCGAGTAATTCCCAAACAGCAGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024679.2-413s21c1
Sequence:CCGGCTCCTTGCCAGAGCTATTATGCTCGAGCATAATAGCTCTGGCAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024679.2-141s21c1
Sequence:CCGGTGCTCCATGCCCTACTCAAACCTCGAGGTTTGAGTAGGGCATGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024679.2-282s21c1
Sequence:CCGGCTGCCAGACAACCTATGTAAACTCGAGTTTACATAGGTTGTCTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024679
C1orf68 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 68
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024679.2-221s21c1
Sequence:CCGGGCCAGAGGACCTATGTGAAATCTCGAGATTTCACATAGGTCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024679.2-674s21c1
Sequence:CCGGGGTGCTGCTGTTTGGGAATTACTCGAGTAATTCCCAAACAGCAGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024679.2-413s21c1
Sequence:CCGGCTCCTTGCCAGAGCTATTATGCTCGAGCATAATAGCTCTGGCAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024679.2-141s21c1
Sequence:CCGGTGCTCCATGCCCTACTCAAACCTCGAGGTTTGAGTAGGGCATGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024679.2-282s21c1
Sequence:CCGGCTGCCAGACAACCTATGTAAACTCGAGTTTACATAGGTTGTCTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks