EMAIL THIS PAGE TO A FRIEND

C1orf74

chromosome 1 open reading frame 74

UniProtKB ID: Q96LT6
Gene ID:
chicken(771943) chromosome 26 open reading frame, human C1orf74
24 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152485 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152485 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152485 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039831 MISSION® esiRNA esiRNA human C1orf74 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152485 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152485 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366260 predicted 965
2 SASI_Hs01_00240677 predicted 881
3 SASI_Hs01_00240678 predicted 736
4 SASI_Hs01_00240679 predicted 1132
5 SASI_Hs01_00240680 predicted 255
6 SASI_Hs01_00240681 predicted 485
7 SASI_Hs01_00240682 predicted 660
8 SASI_Hs02_00366261 predicted 1075
9 SASI_Hs01_00240683 predicted 247
10 SASI_Hs01_00240684 predicted 744
11 SASI_Hs01_00240676 predicted 823
12 SASI_Hs01_00240685 predicted 1062
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152485
C1orf74 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 74
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152485.2-1487s21c1
Sequence:CCGGAGACCACCAGTATGCTTAAATCTCGAGATTTAAGCATACTGGTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152485.2-1198s21c1
Sequence:CCGGAGGGCATGTAAATAGGTAATGCTCGAGCATTACCTATTTACATGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152485.2-743s21c1
Sequence:CCGGGGAATCTGTGTACTGTATTTGCTCGAGCAAATACAGTACACAGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152485.2-525s21c1
Sequence:CCGGTGTCAGTCCTGAGCATGTATGCTCGAGCATACATGCTCAGGACTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116072    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152485.2-1133s1c1
Sequence:CCGGGCCAATTCCAAGTGTCTTGAACTCGAGTTCAAGACACTTGGAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152485.2-973s1c1
Sequence:CCGGACCCGATTTAGGACTCAGAATCTCGAGATTCTGAGTCCTAAATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152485.2-575s1c1
Sequence:CCGGCCATAGCCTTTGTGGATGTTTCTCGAGAAACATCCACAAAGGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152485.2-830s1c1
Sequence:CCGGCTCTGACTCCACTACGAGTATCTCGAGATACTCGTAGTGGAGTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152485.2-776s1c1
Sequence:CCGGGCTATCCTGTTCCCTATACCTCTCGAGAGGTATAGGGAACAGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152485
C1orf74 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 74
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152485.2-1487s21c1
Sequence:CCGGAGACCACCAGTATGCTTAAATCTCGAGATTTAAGCATACTGGTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152485.2-1198s21c1
Sequence:CCGGAGGGCATGTAAATAGGTAATGCTCGAGCATTACCTATTTACATGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152485.2-743s21c1
Sequence:CCGGGGAATCTGTGTACTGTATTTGCTCGAGCAAATACAGTACACAGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152485.2-525s21c1
Sequence:CCGGTGTCAGTCCTGAGCATGTATGCTCGAGCATACATGCTCAGGACTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116072    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152485.2-1133s1c1
Sequence:CCGGGCCAATTCCAAGTGTCTTGAACTCGAGTTCAAGACACTTGGAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152485.2-973s1c1
Sequence:CCGGACCCGATTTAGGACTCAGAATCTCGAGATTCTGAGTCCTAAATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152485.2-575s1c1
Sequence:CCGGCCATAGCCTTTGTGGATGTTTCTCGAGAAACATCCACAAAGGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152485.2-830s1c1
Sequence:CCGGCTCTGACTCCACTACGAGTATCTCGAGATACTCGTAGTGGAGTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152485.2-776s1c1
Sequence:CCGGGCTATCCTGTTCCCTATACCTCTCGAGAGGTATAGGGAACAGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152485
C1orf74 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 74
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152485.2-1487s21c1
Sequence:CCGGAGACCACCAGTATGCTTAAATCTCGAGATTTAAGCATACTGGTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152485.2-1198s21c1
Sequence:CCGGAGGGCATGTAAATAGGTAATGCTCGAGCATTACCTATTTACATGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152485.2-743s21c1
Sequence:CCGGGGAATCTGTGTACTGTATTTGCTCGAGCAAATACAGTACACAGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152485.2-525s21c1
Sequence:CCGGTGTCAGTCCTGAGCATGTATGCTCGAGCATACATGCTCAGGACTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116072    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152485.2-1133s1c1
Sequence:CCGGGCCAATTCCAAGTGTCTTGAACTCGAGTTCAAGACACTTGGAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152485.2-973s1c1
Sequence:CCGGACCCGATTTAGGACTCAGAATCTCGAGATTCTGAGTCCTAAATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152485.2-575s1c1
Sequence:CCGGCCATAGCCTTTGTGGATGTTTCTCGAGAAACATCCACAAAGGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152485.2-830s1c1
Sequence:CCGGCTCTGACTCCACTACGAGTATCTCGAGATACTCGTAGTGGAGTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152485.2-776s1c1
Sequence:CCGGGCTATCCTGTTCCCTATACCTCTCGAGAGGTATAGGGAACAGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks