EMAIL THIS PAGE TO A FRIEND

C1orf85

chromosome 1 open reading frame 85

32 Gene Product Result for
Synonyms: NCU-G1
Species: Human C1orf85(112770)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144580 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144580 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144580 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126381 MISSION® esiRNA esiRNA human C1orf85 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144580 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144580 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189568 predicted 338
2 SASI_Hs01_00189569 predicted 465
3 SASI_Hs01_00189570 predicted 276
4 SASI_Hs01_00189572 predicted 959
5 SASI_Hs01_00189573 predicted 198
6 SASI_Hs01_00189574 predicted 467
7 SASI_Hs01_00189575 predicted 453
8 SASI_Hs01_00189576 predicted 198
9 SASI_Hs01_00189577 predicted 452
10 SASI_Hs02_00364365 predicted 1037
11 SASI_Hs01_00189571 predicted 967
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144580
VALIDATED
C1orf85 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 85
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116122    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_144580.1-1293s1c1
Sequence:CCGGTGGAGGTTGGAGCATCAAGTTCTCGAGAACTTGATGCTCCAACCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144580.1-988s1c1
Sequence:CCGGCCAGAATAACTTCTGTGCCTTCTCGAGAAGGCACAGAAGTTATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144580.1-932s1c1
Sequence:CCGGCCTGCCTTAGCATACTCTCTTCTCGAGAAGAGAGTATGCTAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_144580.1-415s1c1
Sequence:CCGGCGTGTCCGATACGGCAGCAAACTCGAGTTTGCTGCCGTATCGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144580.1-73s1c1
Sequence:CCGGCCTTTGGACTCTACTTCTGTTCTCGAGAACAGAAGTAGAGTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_144580.1-457s21c1
Sequence:CCGGTCCATACTCCTTGGCCGATTTCTCGAGAAATCGGCCAAGGAGTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_144580.1-772s21c1
Sequence:CCGGGCACTCCATCGACGATGAATACTCGAGTATTCATCGTCGATGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_144580.1-932s21c1
Sequence:CCGGCCTGCCTTAGCATACTCTCTTCTCGAGAAGAGAGTATGCTAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_144580.1-415s21c1
Sequence:CCGGCGTGTCCGATACGGCAGCAAACTCGAGTTTGCTGCCGTATCGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144580
VALIDATED
C1orf85 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 85
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116122    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_144580.1-1293s1c1
Sequence:CCGGTGGAGGTTGGAGCATCAAGTTCTCGAGAACTTGATGCTCCAACCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144580.1-988s1c1
Sequence:CCGGCCAGAATAACTTCTGTGCCTTCTCGAGAAGGCACAGAAGTTATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144580.1-932s1c1
Sequence:CCGGCCTGCCTTAGCATACTCTCTTCTCGAGAAGAGAGTATGCTAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_144580.1-415s1c1
Sequence:CCGGCGTGTCCGATACGGCAGCAAACTCGAGTTTGCTGCCGTATCGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144580.1-73s1c1
Sequence:CCGGCCTTTGGACTCTACTTCTGTTCTCGAGAACAGAAGTAGAGTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_144580.1-457s21c1
Sequence:CCGGTCCATACTCCTTGGCCGATTTCTCGAGAAATCGGCCAAGGAGTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_144580.1-772s21c1
Sequence:CCGGGCACTCCATCGACGATGAATACTCGAGTATTCATCGTCGATGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_144580.1-932s21c1
Sequence:CCGGCCTGCCTTAGCATACTCTCTTCTCGAGAAGAGAGTATGCTAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_144580.1-415s21c1
Sequence:CCGGCGTGTCCGATACGGCAGCAAACTCGAGTTTGCTGCCGTATCGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144580
VALIDATED
C1orf85 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 85
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116122    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_144580.1-1293s1c1
Sequence:CCGGTGGAGGTTGGAGCATCAAGTTCTCGAGAACTTGATGCTCCAACCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144580.1-988s1c1
Sequence:CCGGCCAGAATAACTTCTGTGCCTTCTCGAGAAGGCACAGAAGTTATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144580.1-932s1c1
Sequence:CCGGCCTGCCTTAGCATACTCTCTTCTCGAGAAGAGAGTATGCTAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_144580.1-415s1c1
Sequence:CCGGCGTGTCCGATACGGCAGCAAACTCGAGTTTGCTGCCGTATCGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144580.1-73s1c1
Sequence:CCGGCCTTTGGACTCTACTTCTGTTCTCGAGAACAGAAGTAGAGTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_144580.1-457s21c1
Sequence:CCGGTCCATACTCCTTGGCCGATTTCTCGAGAAATCGGCCAAGGAGTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_144580.1-772s21c1
Sequence:CCGGGCACTCCATCGACGATGAATACTCGAGTATTCATCGTCGATGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_144580.1-932s21c1
Sequence:CCGGCCTGCCTTAGCATACTCTCTTCTCGAGAAGAGAGTATGCTAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_144580.1-415s21c1
Sequence:CCGGCGTGTCCGATACGGCAGCAAACTCGAGTTTGCTGCCGTATCGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks