EMAIL THIS PAGE TO A FRIEND

C1orf86

chromosome 1 open reading frame 86

28 Gene Product Result for
Synonyms: FAAP20 FP7162
Species: Human C1orf86(199990)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA038829 Anti-FAAP20 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182533 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182533 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182533 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU128111 MISSION® esiRNA esiRNA human C1orf86 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182533 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182533 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370631 predicted 319
2 SASI_Hs02_00370632 predicted 495
3 SASI_Hs02_00370633 predicted 315
4 SASI_Hs02_00370634 predicted 555
5 SASI_Hs02_00370635 predicted 253
6 SASI_Hs02_00370636 predicted 697
7 SASI_Hs02_00370637 predicted 162
8 SASI_Hs02_00370638 predicted 154
9 SASI_Hs02_00370639 predicted 232
10 SASI_Hs02_00370640 predicted 526
11 SASI_Hs01_00138804 predicted 740
12 SASI_Hs01_00138805 predicted 753
13 SASI_Hs01_00138806 predicted 1006
14 SASI_Hs01_00138807 predicted 554
15 SASI_Hs01_00138808 predicted 905
16 SASI_Hs01_00138809 predicted 595
17 SASI_Hs01_00138810 predicted 790
18 SASI_Hs01_00138811 predicted 543
19 SASI_Hs01_00138812 predicted 548
20 SASI_Hs01_00138813 predicted 757
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182533
VALIDATED
C1orf86 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 86
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000172677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182533.1-558s1c1
Sequence:CCGGGTGACGTGTCTTTCATGGATGCTCGAGCATCCATGAAAGACACGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_182533.1-550s1c1
Sequence:CCGGCAGAAGACGTGACGTGTCTTTCTCGAGAAAGACACGTCACGTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172539    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182533.1-2025s1c1
Sequence:CCGGGCTGGTGAACTGTGTGTCAAACTCGAGTTTGACACACAGTTCACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182533.1-552s1c1
Sequence:CCGGGAAGACGTGACGTGTCTTTCACTCGAGTGAAAGACACGTCACGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182533
VALIDATED
C1orf86 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 86
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000172677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182533.1-558s1c1
Sequence:CCGGGTGACGTGTCTTTCATGGATGCTCGAGCATCCATGAAAGACACGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_182533.1-550s1c1
Sequence:CCGGCAGAAGACGTGACGTGTCTTTCTCGAGAAAGACACGTCACGTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172539    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182533.1-2025s1c1
Sequence:CCGGGCTGGTGAACTGTGTGTCAAACTCGAGTTTGACACACAGTTCACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182533.1-552s1c1
Sequence:CCGGGAAGACGTGACGTGTCTTTCACTCGAGTGAAAGACACGTCACGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182533
VALIDATED
C1orf86 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 86
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000172677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182533.1-558s1c1
Sequence:CCGGGTGACGTGTCTTTCATGGATGCTCGAGCATCCATGAAAGACACGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_182533.1-550s1c1
Sequence:CCGGCAGAAGACGTGACGTGTCTTTCTCGAGAAAGACACGTCACGTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172539    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182533.1-2025s1c1
Sequence:CCGGGCTGGTGAACTGTGTGTCAAACTCGAGTTTGACACACAGTTCACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182533.1-552s1c1
Sequence:CCGGGAAGACGTGACGTGTCTTTCACTCGAGTGAAAGACACGTCACGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks