EMAIL THIS PAGE TO A FRIEND

C1orf87

chromosome 1 open reading frame 87

64 Gene Product Result for
Species: Human C1orf87(127795)
UniProtKB ID: Q8N0U7, Q6ZU07, Q8IVS0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152377 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152377 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152377 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029141 MISSION® esiRNA esiRNA human C1orf87 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152377 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152377 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118746 predicted 1708
2 SASI_Hs02_00366030 predicted 688
3 SASI_Hs01_00118747 predicted 290
4 SASI_Hs01_00118748 predicted 1745
5 SASI_Hs01_00118749 predicted 1044
6 SASI_Hs01_00118750 predicted 250
7 SASI_Hs01_00118751 predicted 319
8 SASI_Hs01_00118752 predicted 1261
9 SASI_Hs01_00118753 predicted 1190
10 SASI_Hs02_00366031 predicted 571
11 SASI_Hs01_00118754 predicted 1729
12 SASI_Hs01_00118755 predicted 1031
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152377
C1orf87 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 87
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152377.1-1416s1c1
Sequence:CCGGGCCTGCAAAGATCCTCTGAAACTCGAGTTTCAGAGGATCTTTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152377.1-774s1c1
Sequence:CCGGCCTCTACAGTTACCAACAGTTCTCGAGAACTGTTGGTAACTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152377.1-879s1c1
Sequence:CCGGGCATCAGATTATCCACAGCAACTCGAGTTGCTGTGGATAATCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152377.1-291s1c1
Sequence:CCGGGTTCCCATTAACTTCACTGATCTCGAGATCAGTGAAGTTAATGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152377.1-1332s1c1
Sequence:CCGGCCCGAGATGTCTCAAAGCAAACTCGAGTTTGCTTTGAGACATCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152377.1-929s21c1
Sequence:CCGGTGAGAGTCATGGCACTCATAGCTCGAGCTATGAGTGCCATGACTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152377
C1orf87 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 87
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152377.1-1416s1c1
Sequence:CCGGGCCTGCAAAGATCCTCTGAAACTCGAGTTTCAGAGGATCTTTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152377.1-774s1c1
Sequence:CCGGCCTCTACAGTTACCAACAGTTCTCGAGAACTGTTGGTAACTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152377.1-879s1c1
Sequence:CCGGGCATCAGATTATCCACAGCAACTCGAGTTGCTGTGGATAATCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152377.1-291s1c1
Sequence:CCGGGTTCCCATTAACTTCACTGATCTCGAGATCAGTGAAGTTAATGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152377.1-1332s1c1
Sequence:CCGGCCCGAGATGTCTCAAAGCAAACTCGAGTTTGCTTTGAGACATCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152377.1-929s21c1
Sequence:CCGGTGAGAGTCATGGCACTCATAGCTCGAGCTATGAGTGCCATGACTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152377
C1orf87 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 87
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152377.1-1416s1c1
Sequence:CCGGGCCTGCAAAGATCCTCTGAAACTCGAGTTTCAGAGGATCTTTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152377.1-774s1c1
Sequence:CCGGCCTCTACAGTTACCAACAGTTCTCGAGAACTGTTGGTAACTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152377.1-879s1c1
Sequence:CCGGGCATCAGATTATCCACAGCAACTCGAGTTGCTGTGGATAATCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152377.1-291s1c1
Sequence:CCGGGTTCCCATTAACTTCACTGATCTCGAGATCAGTGAAGTTAATGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152377.1-1332s1c1
Sequence:CCGGCCCGAGATGTCTCAAAGCAAACTCGAGTTTGCTTTGAGACATCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152377.1-929s21c1
Sequence:CCGGTGAGAGTCATGGCACTCATAGCTCGAGCTATGAGTGCCATGACTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks