EMAIL THIS PAGE TO A FRIEND

C1orf94

chromosome 1 open reading frame 94

UniProtKB ID: Q6P1W5, B3KVT1, D3DPR3, E9PJ76, Q96IC8
Gene ID:
chicken(419639) chromosome 23 open reading frame, human C1orf94
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032884 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032884 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032884 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU019221 MISSION® esiRNA esiRNA targeting human C1orf94 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032884 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032884 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196741 predicted 862
2 SASI_Hs01_00196742 predicted 708
3 SASI_Hs01_00196743 predicted 1410
4 SASI_Hs01_00196744 predicted 1387
5 SASI_Hs02_00360506 predicted 1738
6 SASI_Hs01_00196745 predicted 1270
7 SASI_Hs01_00196746 predicted 1053
8 SASI_Hs01_00196747 predicted 1526
9 SASI_Hs01_00196749 predicted 797
10 SASI_Hs02_00360507 predicted 1670
11 SASI_Hs01_00196748 predicted 1257
12 SASI_Hs01_00196750 predicted 1674
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032884
C1orf94 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 94
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032884.3-1600s21c1
Sequence:CCGGTCCAGTGGGAATGGCATAAACCTCGAGGTTTATGCCATTCCCACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032884.3-1253s21c1
Sequence:CCGGACTCTACCTTCTTGCAGTATCCTCGAGGATACTGCAAGAAGGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032884.3-998s21c1
Sequence:CCGGCCGAGAAGAACTTGCTCTATGCTCGAGCATAGAGCAAGTTCTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032884.3-1755s21c1
Sequence:CCGGCAAGACCAGATTCATCTATTGCTCGAGCAATAGATGAATCTGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032884.3-1517s21c1
Sequence:CCGGATGGACCGCAGTACCTCTTTCCTCGAGGAAAGAGGTACTGCGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032884.2-1893s1c1
Sequence:CCGGCAGTGGGAATGGCATAAACTTCTCGAGAAGTTTATGCCATTCCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167084    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032884.2-2162s1c1
Sequence:CCGGCCACTTATGCTTCTGTATTTACTCGAGTAAATACAGAAGCATAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032884
C1orf94 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 94
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032884.3-1600s21c1
Sequence:CCGGTCCAGTGGGAATGGCATAAACCTCGAGGTTTATGCCATTCCCACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032884.3-1253s21c1
Sequence:CCGGACTCTACCTTCTTGCAGTATCCTCGAGGATACTGCAAGAAGGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032884.3-998s21c1
Sequence:CCGGCCGAGAAGAACTTGCTCTATGCTCGAGCATAGAGCAAGTTCTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032884.3-1755s21c1
Sequence:CCGGCAAGACCAGATTCATCTATTGCTCGAGCAATAGATGAATCTGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032884.3-1517s21c1
Sequence:CCGGATGGACCGCAGTACCTCTTTCCTCGAGGAAAGAGGTACTGCGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032884.2-1893s1c1
Sequence:CCGGCAGTGGGAATGGCATAAACTTCTCGAGAAGTTTATGCCATTCCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167084    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032884.2-2162s1c1
Sequence:CCGGCCACTTATGCTTCTGTATTTACTCGAGTAAATACAGAAGCATAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032884
C1orf94 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 94
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032884.3-1600s21c1
Sequence:CCGGTCCAGTGGGAATGGCATAAACCTCGAGGTTTATGCCATTCCCACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032884.3-1253s21c1
Sequence:CCGGACTCTACCTTCTTGCAGTATCCTCGAGGATACTGCAAGAAGGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032884.3-998s21c1
Sequence:CCGGCCGAGAAGAACTTGCTCTATGCTCGAGCATAGAGCAAGTTCTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032884.3-1755s21c1
Sequence:CCGGCAAGACCAGATTCATCTATTGCTCGAGCAATAGATGAATCTGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032884.3-1517s21c1
Sequence:CCGGATGGACCGCAGTACCTCTTTCCTCGAGGAAAGAGGTACTGCGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032884.2-1893s1c1
Sequence:CCGGCAGTGGGAATGGCATAAACTTCTCGAGAAGTTTATGCCATTCCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167084    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032884.2-2162s1c1
Sequence:CCGGCCACTTATGCTTCTGTATTTACTCGAGTAAATACAGAAGCATAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks