EMAIL THIS PAGE TO A FRIEND

C1orf95

chromosome 1 open reading frame 95

43 Gene Product Result for
UniProtKB ID: Q69YW2, A6NGL2
Gene ID:
chicken(421315) chromosome 3 open reading frame, human C1orf95
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100277 Anti-C1ORF95 antibody produced in rabbit affinity isolated antibody bovine, mouse, rabbit, human, rat
western blot pricing
SAB1303967 ANTI-CA095 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001003665 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001003665 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001003665 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003665 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003665 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036046 predicted 2019
2 SASI_Hs01_00036047 predicted 1673
3 SASI_Hs01_00036048 predicted 3499
4 SASI_Hs02_00304303 predicted 2363
5 SASI_Hs01_00036049 predicted 1234
6 SASI_Hs01_00036050 predicted 1901
7 SASI_Hs01_00036052 predicted 1882
8 SASI_Hs01_00036053 predicted 2706
9 SASI_Hs01_00036054 predicted 1677
10 SASI_Hs01_00036055 predicted 3141
11 SASI_Hs01_00036051 predicted 1257
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003665
C1orf95 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 95
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166797    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003665.1-2352s1c1
Sequence:CCGGCCTGTTTGGAAGCCTCTGTATCTCGAGATACAGAGGCTTCCAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165595    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003665.1-3499s1c1
Sequence:CCGGGCGGAGACTGTTGATTTGGATCTCGAGATCCAAATCAACAGTCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003665.1-3087s1c1
Sequence:CCGGGCTGATTTACTCCAAATAGTTCTCGAGAACTATTTGGAGTAAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162235    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003665.1-1574s1c1
Sequence:CCGGCCACTAAGTAACTTAGGGAAACTCGAGTTTCCCTAAGTTACTTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003665.1-440s1c1
Sequence:CCGGGCTGGATCATGAGCATCTTCTCTCGAGAGAAGATGCTCATGATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003665.1-408s1c1
Sequence:CCGGCATCCAAATCCTCACTGCCATCTCGAGATGGCAGTGAGGATTTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165967    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003665.1-3362s1c1
Sequence:CCGGGCAGAGAAAGTCAGAGGCAATCTCGAGATTGCCTCTGACTTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003665
C1orf95 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 95
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166797    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003665.1-2352s1c1
Sequence:CCGGCCTGTTTGGAAGCCTCTGTATCTCGAGATACAGAGGCTTCCAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165595    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003665.1-3499s1c1
Sequence:CCGGGCGGAGACTGTTGATTTGGATCTCGAGATCCAAATCAACAGTCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003665.1-3087s1c1
Sequence:CCGGGCTGATTTACTCCAAATAGTTCTCGAGAACTATTTGGAGTAAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162235    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003665.1-1574s1c1
Sequence:CCGGCCACTAAGTAACTTAGGGAAACTCGAGTTTCCCTAAGTTACTTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003665.1-440s1c1
Sequence:CCGGGCTGGATCATGAGCATCTTCTCTCGAGAGAAGATGCTCATGATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003665.1-408s1c1
Sequence:CCGGCATCCAAATCCTCACTGCCATCTCGAGATGGCAGTGAGGATTTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165967    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003665.1-3362s1c1
Sequence:CCGGGCAGAGAAAGTCAGAGGCAATCTCGAGATTGCCTCTGACTTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003665
C1orf95 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 95
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166797    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003665.1-2352s1c1
Sequence:CCGGCCTGTTTGGAAGCCTCTGTATCTCGAGATACAGAGGCTTCCAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165595    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003665.1-3499s1c1
Sequence:CCGGGCGGAGACTGTTGATTTGGATCTCGAGATCCAAATCAACAGTCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003665.1-3087s1c1
Sequence:CCGGGCTGATTTACTCCAAATAGTTCTCGAGAACTATTTGGAGTAAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162235    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003665.1-1574s1c1
Sequence:CCGGCCACTAAGTAACTTAGGGAAACTCGAGTTTCCCTAAGTTACTTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003665.1-440s1c1
Sequence:CCGGGCTGGATCATGAGCATCTTCTCTCGAGAGAAGATGCTCATGATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003665.1-408s1c1
Sequence:CCGGCATCCAAATCCTCACTGCCATCTCGAGATGGCAGTGAGGATTTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165967    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003665.1-3362s1c1
Sequence:CCGGGCAGAGAAAGTCAGAGGCAATCTCGAGATTGCCTCTGACTTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks