EMAIL THIS PAGE TO A FRIEND

C20orf112

chromosome 20 open reading frame 112

65 Gene Product Result for
Synonyms: C20orf113 dJ1184F4.2 dJ1184F4.4
Species: Human C20orf112(140688)
UniProtKB ID: Q96MY1, Q5JYB7, Q6P0Y4, Q9BR34, Q9NQF6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301672 ANTI-CT112 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080616 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080616 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080616 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU058261 MISSION® esiRNA esiRNA human C20orf112 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080616 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080616 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088174 predicted 897
2 SASI_Hs01_00088175 predicted 878
3 SASI_Hs01_00088176 predicted 779
4 SASI_Hs01_00088177 predicted 879
5 SASI_Hs01_00088178 predicted 879
6 SASI_Hs01_00088179 predicted 1844
7 SASI_Hs01_00088180 predicted 1760
8 SASI_Hs01_00088181 predicted 937
9 SASI_Hs02_00362365 predicted 917
10 SASI_Hs01_00088182 predicted 952
11 SASI_Hs01_00088183 predicted 845
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080616
C20orf112 MISSION shRNA Bacterial Glycerol Stock
chromosome 20 open reading frame 112
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167588    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080616.1-1735s1c1
Sequence:CCGGGTGAGCAGAATTGCATATTTACTCGAGTAAATATGCAATTCTGCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080616.1-920s1c1
Sequence:CCGGGTCTAGAGATCTACCAGTCCTCTCGAGAGGACTGGTAGATCTCTAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080616.1-582s1c1
Sequence:CCGGGATGAACGACTCTGAAGGCATCTCGAGATGCCTTCAGAGTCGTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080616.3-555s21c1
Sequence:CCGGACAGCTCTGGGAGCTACGATTCTCGAGAATCGTAGCTCCCAGAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080616.3-1535s21c1
Sequence:CCGGGCCTCACCAGTTGGTACATTTCTCGAGAAATGTACCAACTGGTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080616.2-797s21c1
Sequence:CCGGCATGGACCCTGAGCGTCTTAACTCGAGTTAAGACGCTCAGGGTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080616.2-824s21c1
Sequence:CCGGCAACATGTTTGTGCGTCTCTTCTCGAGAAGAGACGCACAAACATGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080616.2-5471s21c1
Sequence:CCGGTTTAGTCCTCTGGCATAATTTCTCGAGAAATTATGCCAGAGGACTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080616.2-754s21c1
Sequence:CCGGACGATGACCATGAGGACAATGCTCGAGCATTGTCCTCATGGTCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080616.2-1080s21c1
Sequence:CCGGTGTGAGAGCGAGACAAGAAAGCTCGAGCTTTCTTGTCTCGCTCTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080616.3-1011s21c1
Sequence:CCGGAGCGGATGCGTCTAGAGATCTCTCGAGAGATCTCTAGACGCATCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080616
C20orf112 MISSION shRNA shRNA Plasmid DNA
chromosome 20 open reading frame 112
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167588    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080616.1-1735s1c1
Sequence:CCGGGTGAGCAGAATTGCATATTTACTCGAGTAAATATGCAATTCTGCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080616.1-920s1c1
Sequence:CCGGGTCTAGAGATCTACCAGTCCTCTCGAGAGGACTGGTAGATCTCTAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080616.1-582s1c1
Sequence:CCGGGATGAACGACTCTGAAGGCATCTCGAGATGCCTTCAGAGTCGTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080616.3-555s21c1
Sequence:CCGGACAGCTCTGGGAGCTACGATTCTCGAGAATCGTAGCTCCCAGAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080616.3-1535s21c1
Sequence:CCGGGCCTCACCAGTTGGTACATTTCTCGAGAAATGTACCAACTGGTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080616.2-797s21c1
Sequence:CCGGCATGGACCCTGAGCGTCTTAACTCGAGTTAAGACGCTCAGGGTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080616.2-824s21c1
Sequence:CCGGCAACATGTTTGTGCGTCTCTTCTCGAGAAGAGACGCACAAACATGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080616.2-5471s21c1
Sequence:CCGGTTTAGTCCTCTGGCATAATTTCTCGAGAAATTATGCCAGAGGACTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080616.2-754s21c1
Sequence:CCGGACGATGACCATGAGGACAATGCTCGAGCATTGTCCTCATGGTCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080616.2-1080s21c1
Sequence:CCGGTGTGAGAGCGAGACAAGAAAGCTCGAGCTTTCTTGTCTCGCTCTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080616.3-1011s21c1
Sequence:CCGGAGCGGATGCGTCTAGAGATCTCTCGAGAGATCTCTAGACGCATCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080616
C20orf112 MISSION shRNA Lentiviral Transduction Particles
chromosome 20 open reading frame 112
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167588    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080616.1-1735s1c1
Sequence:CCGGGTGAGCAGAATTGCATATTTACTCGAGTAAATATGCAATTCTGCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080616.1-920s1c1
Sequence:CCGGGTCTAGAGATCTACCAGTCCTCTCGAGAGGACTGGTAGATCTCTAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080616.1-582s1c1
Sequence:CCGGGATGAACGACTCTGAAGGCATCTCGAGATGCCTTCAGAGTCGTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080616.3-555s21c1
Sequence:CCGGACAGCTCTGGGAGCTACGATTCTCGAGAATCGTAGCTCCCAGAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080616.3-1535s21c1
Sequence:CCGGGCCTCACCAGTTGGTACATTTCTCGAGAAATGTACCAACTGGTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080616.2-797s21c1
Sequence:CCGGCATGGACCCTGAGCGTCTTAACTCGAGTTAAGACGCTCAGGGTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080616.2-824s21c1
Sequence:CCGGCAACATGTTTGTGCGTCTCTTCTCGAGAAGAGACGCACAAACATGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080616.2-5471s21c1
Sequence:CCGGTTTAGTCCTCTGGCATAATTTCTCGAGAAATTATGCCAGAGGACTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080616.2-754s21c1
Sequence:CCGGACGATGACCATGAGGACAATGCTCGAGCATTGTCCTCATGGTCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080616.2-1080s21c1
Sequence:CCGGTGTGAGAGCGAGACAAGAAAGCTCGAGCTTTCTTGTCTCGCTCTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080616.3-1011s21c1
Sequence:CCGGAGCGGATGCGTCTAGAGATCTCTCGAGAGATCTCTAGACGCATCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)