EMAIL THIS PAGE TO A FRIEND

C20orf141

chromosome 20 open reading frame 141

164 Gene Product Result for
Synonyms: dJ860F19.4
Species: Human C20orf141(128653)
UniProtKB ID: Q9NUB4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV52519 Anti-C20ORF141 (AB1) antibody produced in rabbit affinity isolated antibody bovine, mouse, human
western blot pricing
AV52520 Anti-C20ORF141 (AB2) antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080739 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080739 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080739 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040201 MISSION® esiRNA esiRNA human C20orf141 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080739 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080739 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021290 predicted 442
2 SASI_Hs01_00021291 predicted 440
3 SASI_Hs01_00021292 predicted 406
4 SASI_Hs01_00021293 predicted 489
5 SASI_Hs01_00021294 predicted 204
6 SASI_Hs01_00021295 predicted 292
7 SASI_Hs01_00021296 predicted 403
8 SASI_Hs01_00021297 predicted 443
9 SASI_Hs01_00021298 predicted 345
10 SASI_Hs01_00021299 predicted 445
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080739
C20orf141 MISSION shRNA Bacterial Glycerol Stock
chromosome 20 open reading frame 141
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080739.2-414s21c1
Sequence:CCGGCACCTTTGACCTGCTCCATAGCTCGAGCTATGGAGCAGGTCAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080739.2-448s21c1
Sequence:CCGGACTCTGCCACAGCGCAAACTTCTCGAGAAGTTTGCGCTGTGGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080739.2-516s21c1
Sequence:CCGGGGAGGCTCTACTCCTGCAAATCTCGAGATTTGCAGGAGTAGAGCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080739.2-527s21c1
Sequence:CCGGTCCTGCAAATGGGTACAGTCTCTCGAGAGACTGTACCCATTTGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080739.2-267s21c1
Sequence:CCGGTCCAGTGCGTCCACCTGTATCCTCGAGGATACAGGTGGACGCACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080739.2-538s21c1
Sequence:CCGGGGTACAGTCTCAGGACAACTTCTCGAGAAGTTGTCCTGAGACTGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080739.2-401s21c1
Sequence:CCGGTGGTCAGCTTCCTCACCTTTGCTCGAGCAAAGGTGAGGAAGCTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080739.2-349s21c1
Sequence:CCGGCTGACAATCCAGGCAGTCTTTCTCGAGAAAGACTGCCTGGATTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080739.2-215s21c1
Sequence:CCGGATCCGATCCCAGTTCCTCCAACTCGAGTTGGAGGAACTGGGATCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080739
C20orf141 MISSION shRNA shRNA Plasmid DNA
chromosome 20 open reading frame 141
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080739.2-414s21c1
Sequence:CCGGCACCTTTGACCTGCTCCATAGCTCGAGCTATGGAGCAGGTCAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080739.2-448s21c1
Sequence:CCGGACTCTGCCACAGCGCAAACTTCTCGAGAAGTTTGCGCTGTGGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080739.2-516s21c1
Sequence:CCGGGGAGGCTCTACTCCTGCAAATCTCGAGATTTGCAGGAGTAGAGCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080739.2-527s21c1
Sequence:CCGGTCCTGCAAATGGGTACAGTCTCTCGAGAGACTGTACCCATTTGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080739.2-267s21c1
Sequence:CCGGTCCAGTGCGTCCACCTGTATCCTCGAGGATACAGGTGGACGCACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080739.2-538s21c1
Sequence:CCGGGGTACAGTCTCAGGACAACTTCTCGAGAAGTTGTCCTGAGACTGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080739.2-401s21c1
Sequence:CCGGTGGTCAGCTTCCTCACCTTTGCTCGAGCAAAGGTGAGGAAGCTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080739.2-349s21c1
Sequence:CCGGCTGACAATCCAGGCAGTCTTTCTCGAGAAAGACTGCCTGGATTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080739.2-215s21c1
Sequence:CCGGATCCGATCCCAGTTCCTCCAACTCGAGTTGGAGGAACTGGGATCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080739
C20orf141 MISSION shRNA Lentiviral Transduction Particles
chromosome 20 open reading frame 141
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080739.2-414s21c1
Sequence:CCGGCACCTTTGACCTGCTCCATAGCTCGAGCTATGGAGCAGGTCAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080739.2-448s21c1
Sequence:CCGGACTCTGCCACAGCGCAAACTTCTCGAGAAGTTTGCGCTGTGGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080739.2-516s21c1
Sequence:CCGGGGAGGCTCTACTCCTGCAAATCTCGAGATTTGCAGGAGTAGAGCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080739.2-527s21c1
Sequence:CCGGTCCTGCAAATGGGTACAGTCTCTCGAGAGACTGTACCCATTTGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080739.2-267s21c1
Sequence:CCGGTCCAGTGCGTCCACCTGTATCCTCGAGGATACAGGTGGACGCACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080739.2-538s21c1
Sequence:CCGGGGTACAGTCTCAGGACAACTTCTCGAGAAGTTGTCCTGAGACTGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080739.2-401s21c1
Sequence:CCGGTGGTCAGCTTCCTCACCTTTGCTCGAGCAAAGGTGAGGAAGCTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080739.2-349s21c1
Sequence:CCGGCTGACAATCCAGGCAGTCTTTCTCGAGAAAGACTGCCTGGATTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080739.2-215s21c1
Sequence:CCGGATCCGATCCCAGTTCCTCCAACTCGAGTTGGAGGAACTGGGATCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks