EMAIL THIS PAGE TO A FRIEND

C20orf144

chromosome 20 open reading frame 144

18 Gene Product Result for
Synonyms: dJ63M2.6
Species: Human C20orf144(128864)
UniProtKB ID: Q9BQM9, Q1AHR2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080825 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080825 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080825 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080825 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080825 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207121 predicted 203
2 SASI_Hs01_00207122 predicted 195
3 SASI_Hs01_00207123 predicted 204
4 SASI_Hs01_00207124 predicted 198
5 SASI_Hs01_00207125 predicted 298
6 SASI_Hs01_00207126 predicted 295
7 SASI_Hs01_00207127 predicted 296
8 SASI_Hs01_00207128 predicted 146
9 SASI_Hs02_00362601 predicted 151
10 SASI_Hs01_00207129 predicted 473
11 SASI_Hs01_00207130 predicted 485
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080825
C20orf144 MISSION shRNA Bacterial Glycerol Stock
chromosome 20 open reading frame 144
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000282869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080825.2-206s21c1
Sequence:CCGGCAACGCTGGGCAACGGATTGACTCGAGTCAATCCGTTGCCCAGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080825.2-103s21c1
Sequence:CCGGTGGACAAGGCCTGGTGGAAATCTCGAGATTTCCACCAGGCCTTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080825.2-131s21c1
Sequence:CCGGCAACCACCTCACTCGGAAGAACTCGAGTTCTTCCGAGTGAGGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080825.2-157s21c1
Sequence:CCGGCTACCAGGATCGTGCTGATTCCTCGAGGAATCAGCACGATCCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080825
C20orf144 MISSION shRNA shRNA Plasmid DNA
chromosome 20 open reading frame 144
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000282869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080825.2-206s21c1
Sequence:CCGGCAACGCTGGGCAACGGATTGACTCGAGTCAATCCGTTGCCCAGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080825.2-103s21c1
Sequence:CCGGTGGACAAGGCCTGGTGGAAATCTCGAGATTTCCACCAGGCCTTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080825.2-131s21c1
Sequence:CCGGCAACCACCTCACTCGGAAGAACTCGAGTTCTTCCGAGTGAGGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080825.2-157s21c1
Sequence:CCGGCTACCAGGATCGTGCTGATTCCTCGAGGAATCAGCACGATCCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080825
C20orf144 MISSION shRNA Lentiviral Transduction Particles
chromosome 20 open reading frame 144
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000282869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080825.2-206s21c1
Sequence:CCGGCAACGCTGGGCAACGGATTGACTCGAGTCAATCCGTTGCCCAGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080825.2-103s21c1
Sequence:CCGGTGGACAAGGCCTGGTGGAAATCTCGAGATTTCCACCAGGCCTTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080825.2-131s21c1
Sequence:CCGGCAACCACCTCACTCGGAAGAACTCGAGTTCTTCCGAGTGAGGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080825.2-157s21c1
Sequence:CCGGCTACCAGGATCGTGCTGATTCCTCGAGGAATCAGCACGATCCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks