EMAIL THIS PAGE TO A FRIEND

C20orf166-AS1

C20orf166 antisense RNA 1

17 Gene Product Result for
Synonyms: C20orf200 NCRNA00335
UniProtKB ID: Q96NR2, Q52LN1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152757 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152757 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152757 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU084861 MISSION® esiRNA esiRNA human C20orf200 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152757 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152757 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088484 predicted 770
2 SASI_Hs01_00088485 predicted 774
3 SASI_Hs01_00088486 predicted 868
4 SASI_Hs02_00366685 predicted 650
5 SASI_Hs02_00366686 predicted 660
6 SASI_Hs01_00088487 predicted 768
7 SASI_Hs01_00088488 predicted 1280
8 SASI_Hs01_00088489 predicted 1283
9 SASI_Hs01_00088490 predicted 1302
10 SASI_Hs02_00366687 predicted 1257
11 SASI_Hs01_00088491 predicted 1705
12 SASI_Hs01_00088492 predicted 1914
13 SASI_Hs01_00088493 predicted 1481
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152757
C20orf166-AS1 MISSION shRNA Bacterial Glycerol Stock
C20orf166 antisense RNA 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152757.1-678s1c1
Sequence:CCGGCCATCTGATTCTGGATTCCAGCTCGAGCTGGAATCCAGAATCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166400    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152757.1-1007s1c1
Sequence:CCGGCCACAATTCCTTGGCATTCCTCTCGAGAGGAATGCCAAGGAATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152757.1-672s1c1
Sequence:CCGGGAAGGACCATCTGATTCTGGACTCGAGTCCAGAATCAGATGGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161484    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152757.1-2298s1c1
Sequence:CCGGGTTGTTGAGAAGTGTGTCATACTCGAGTATGACACACTTCTCAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162955    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152757.1-875s1c1
Sequence:CCGGGAAATTCACACAGTCAAGGTGCTCGAGCACCTTGACTGTGTGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152757.1-872s1c1
Sequence:CCGGGCAGAAATTCACACAGTCAAGCTCGAGCTTGACTGTGTGAATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164066    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152757.1-1288s1c1
Sequence:CCGGCAGAGGACCAAGTGAATGAATCTCGAGATTCATTCACTTGGTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165118    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152757.1-1004s1c1
Sequence:CCGGCACCCACAATTCCTTGGCATTCTCGAGAATGCCAAGGAATTGTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165766    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152757.1-2274s1c1
Sequence:CCGGCACAGTGAGTTCTCACGAGATCTCGAGATCTCGTGAGAACTCACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152757
C20orf166-AS1 MISSION shRNA shRNA Plasmid DNA
C20orf166 antisense RNA 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152757.1-678s1c1
Sequence:CCGGCCATCTGATTCTGGATTCCAGCTCGAGCTGGAATCCAGAATCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166400    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152757.1-1007s1c1
Sequence:CCGGCCACAATTCCTTGGCATTCCTCTCGAGAGGAATGCCAAGGAATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152757.1-672s1c1
Sequence:CCGGGAAGGACCATCTGATTCTGGACTCGAGTCCAGAATCAGATGGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161484    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152757.1-2298s1c1
Sequence:CCGGGTTGTTGAGAAGTGTGTCATACTCGAGTATGACACACTTCTCAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162955    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152757.1-875s1c1
Sequence:CCGGGAAATTCACACAGTCAAGGTGCTCGAGCACCTTGACTGTGTGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152757.1-872s1c1
Sequence:CCGGGCAGAAATTCACACAGTCAAGCTCGAGCTTGACTGTGTGAATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164066    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152757.1-1288s1c1
Sequence:CCGGCAGAGGACCAAGTGAATGAATCTCGAGATTCATTCACTTGGTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165118    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152757.1-1004s1c1
Sequence:CCGGCACCCACAATTCCTTGGCATTCTCGAGAATGCCAAGGAATTGTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165766    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152757.1-2274s1c1
Sequence:CCGGCACAGTGAGTTCTCACGAGATCTCGAGATCTCGTGAGAACTCACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152757
C20orf166-AS1 MISSION shRNA Lentiviral Transduction Particles
C20orf166 antisense RNA 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152757.1-678s1c1
Sequence:CCGGCCATCTGATTCTGGATTCCAGCTCGAGCTGGAATCCAGAATCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166400    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152757.1-1007s1c1
Sequence:CCGGCCACAATTCCTTGGCATTCCTCTCGAGAGGAATGCCAAGGAATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152757.1-672s1c1
Sequence:CCGGGAAGGACCATCTGATTCTGGACTCGAGTCCAGAATCAGATGGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161484    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152757.1-2298s1c1
Sequence:CCGGGTTGTTGAGAAGTGTGTCATACTCGAGTATGACACACTTCTCAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162955    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152757.1-875s1c1
Sequence:CCGGGAAATTCACACAGTCAAGGTGCTCGAGCACCTTGACTGTGTGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152757.1-872s1c1
Sequence:CCGGGCAGAAATTCACACAGTCAAGCTCGAGCTTGACTGTGTGAATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164066    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152757.1-1288s1c1
Sequence:CCGGCAGAGGACCAAGTGAATGAATCTCGAGATTCATTCACTTGGTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165118    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152757.1-1004s1c1
Sequence:CCGGCACCCACAATTCCTTGGCATTCTCGAGAATGCCAAGGAATTGTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165766    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152757.1-2274s1c1
Sequence:CCGGCACAGTGAGTTCTCACGAGATCTCGAGATCTCGTGAGAACTCACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks