EMAIL THIS PAGE TO A FRIEND

C20orf166

chromosome 20 open reading frame 166

17 Gene Product Result for
Synonyms: dJ353C17.1
Species: Human C20orf166(128826)
UniProtKB ID: Q9H1L0, Q2TB30
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA045553 Anti-MIR1-1HG antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178463 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178463 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178463 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178463 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178463 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159203 predicted 975
2 SASI_Hs01_00159204 predicted 926
3 SASI_Hs01_00159205 predicted 887
4 SASI_Hs01_00159207 predicted 914
5 SASI_Hs01_00159208 predicted 919
6 SASI_Hs01_00159211 predicted 910
7 SASI_Hs01_00159212 predicted 914
8 SASI_Hs02_00369707 predicted 886
9 SASI_Hs02_00369708 predicted 836
10 SASI_Hs02_00369709 predicted 908
11 SASI_Hs01_00159206 predicted 798
12 SASI_Hs01_00159209 predicted 799
13 SASI_Hs01_00159210 predicted 795
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178463
C20orf166 MISSION shRNA Bacterial Glycerol Stock
chromosome 20 open reading frame 166
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000189414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178463.1-589s1c1
Sequence:CCGGCTCTTTGTCAATGCTGAGGCACTCGAGTGCCTCAGCATTGACAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178463.1-591s1c1
Sequence:CCGGCTTTGTCAATGCTGAGGCATTCTCGAGAATGCCTCAGCATTGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178463.1-530s1c1
Sequence:CCGGGCCCTGAAATGTCCATTACTCCTCGAGGAGTAATGGACATTTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178463.1-528s1c1
Sequence:CCGGCAGCCCTGAAATGTCCATTACCTCGAGGTAATGGACATTTCAGGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178463.1-535s1c1
Sequence:CCGGGAAATGTCCATTACTCACAAACTCGAGTTTGTGAGTAATGGACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178463.1-666s1c1
Sequence:CCGGGAAGTTCAGCACATCTGTGCTCTCGAGAGCACAGATGTGCTGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178463
C20orf166 MISSION shRNA shRNA Plasmid DNA
chromosome 20 open reading frame 166
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000189414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178463.1-589s1c1
Sequence:CCGGCTCTTTGTCAATGCTGAGGCACTCGAGTGCCTCAGCATTGACAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178463.1-591s1c1
Sequence:CCGGCTTTGTCAATGCTGAGGCATTCTCGAGAATGCCTCAGCATTGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178463.1-530s1c1
Sequence:CCGGGCCCTGAAATGTCCATTACTCCTCGAGGAGTAATGGACATTTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178463.1-528s1c1
Sequence:CCGGCAGCCCTGAAATGTCCATTACCTCGAGGTAATGGACATTTCAGGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178463.1-535s1c1
Sequence:CCGGGAAATGTCCATTACTCACAAACTCGAGTTTGTGAGTAATGGACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178463.1-666s1c1
Sequence:CCGGGAAGTTCAGCACATCTGTGCTCTCGAGAGCACAGATGTGCTGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178463
C20orf166 MISSION shRNA Lentiviral Transduction Particles
chromosome 20 open reading frame 166
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000189414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178463.1-589s1c1
Sequence:CCGGCTCTTTGTCAATGCTGAGGCACTCGAGTGCCTCAGCATTGACAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178463.1-591s1c1
Sequence:CCGGCTTTGTCAATGCTGAGGCATTCTCGAGAATGCCTCAGCATTGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178463.1-530s1c1
Sequence:CCGGGCCCTGAAATGTCCATTACTCCTCGAGGAGTAATGGACATTTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178463.1-528s1c1
Sequence:CCGGCAGCCCTGAAATGTCCATTACCTCGAGGTAATGGACATTTCAGGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178463.1-535s1c1
Sequence:CCGGGAAATGTCCATTACTCACAAACTCGAGTTTGTGAGTAATGGACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178463.1-666s1c1
Sequence:CCGGGAAGTTCAGCACATCTGTGCTCTCGAGAGCACAGATGTGCTGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks