EMAIL THIS PAGE TO A FRIEND

C20orf173

chromosome 20 open reading frame 173

44 Gene Product Result for
Synonyms: dJ477O4.4
Species: Human C20orf173(140873)
UniProtKB ID: Q96LM9, A6PVJ1, Q2M293, Q5JWS4, Q9H449
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301395 ANTI-CT173 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080828 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080828 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080828 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080828 Rosetta Predictions human pricing
XR_042063 Rosetta Predictions human pricing
XR_042064 Rosetta Predictions human pricing
XR_042065 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080828 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244264 predicted 762
2 SASI_Hs01_00244265 predicted 417
3 SASI_Hs01_00244266 predicted 677
4 SASI_Hs01_00244267 predicted 688
5 SASI_Hs01_00244268 predicted 781
6 SASI_Hs01_00244269 predicted 580
7 SASI_Hs01_00244270 predicted 674
8 SASI_Hs01_00244271 predicted 680
9 SASI_Hs01_00244272 predicted 468
10 SASI_Hs01_00244273 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042063 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00532767 predicted 199
2 SASI_Hs02_00532768 predicted 220
3 SASI_Hs02_00532769 predicted 756
4 SASI_Hs02_00532770 predicted 409
5 SASI_Hs02_00532771 predicted 673
6 SASI_Hs02_00532772 predicted 676
7 SASI_Hs02_00532773 predicted 779
8 SASI_Hs02_00532774 predicted 574
9 SASI_Hs02_00532775 predicted 672
10 SASI_Hs02_00532776 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042064 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00532777 predicted 202
2 SASI_Hs02_00532778 predicted 228
3 SASI_Hs02_00532779 predicted 750
4 SASI_Hs02_00532780 predicted 407
5 SASI_Hs02_00532781 predicted 671
6 SASI_Hs02_00532782 predicted 677
7 SASI_Hs02_00532783 predicted 776
8 SASI_Hs02_00532784 predicted 570
9 SASI_Hs02_00532785 predicted 671
10 SASI_Hs02_00532786 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042065 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00532787 predicted 201
2 SASI_Hs02_00532788 predicted 223
3 SASI_Hs02_00532789 predicted 756
4 SASI_Hs02_00532790 predicted 406
5 SASI_Hs02_00532791 predicted 670
6 SASI_Hs02_00532792 predicted 677
7 SASI_Hs02_00532793 predicted 783
8 SASI_Hs02_00532794 predicted 568
9 SASI_Hs02_00532795 predicted 666
10 SASI_Hs02_00532796 predicted 235
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080828
C20orf173 MISSION shRNA Bacterial Glycerol Stock
chromosome 20 open reading frame 173
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080828.1-450s1c1
Sequence:CCGGGCTTGGGAAATTGTGGAGGAACTCGAGTTCCTCCACAATTTCCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080828.1-673s1c1
Sequence:CCGGGTGTGGACTTCAGATGCTCTACTCGAGTAGAGCATCTGAAGTCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163503    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080828.1-866s1c1
Sequence:CCGGGCAGAAATCGAAGTCATCCATCTCGAGATGGATGACTTCGATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080828.1-465s1c1
Sequence:CCGGGAGGAAGCTGTTTAAAGGGATCTCGAGATCCCTTTAAACAGCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159581    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080828.1-763s1c1
Sequence:CCGGCTTTGGATTTGGATCAGAATACTCGAGTATTCTGATCCAAATCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162226    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080828.1-777s1c1
Sequence:CCGGCAGAATAGCAAGGAAAGTGTTCTCGAGAACACTTTCCTTGCTATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080828.1-683s1c1
Sequence:CCGGCAGATGCTCTAAGTGATAAGACTCGAGTCTTATCACTTAGAGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163289    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080828.1-808s1c1
Sequence:CCGGGAAGGAGGATAATCAGACCAACTCGAGTTGGTCTGATTATCCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080828.1-678s1c1
Sequence:CCGGGACTTCAGATGCTCTAAGTGACTCGAGTCACTTAGAGCATCTGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080828
C20orf173 MISSION shRNA shRNA Plasmid DNA
chromosome 20 open reading frame 173
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080828.1-450s1c1
Sequence:CCGGGCTTGGGAAATTGTGGAGGAACTCGAGTTCCTCCACAATTTCCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080828.1-673s1c1
Sequence:CCGGGTGTGGACTTCAGATGCTCTACTCGAGTAGAGCATCTGAAGTCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163503    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080828.1-866s1c1
Sequence:CCGGGCAGAAATCGAAGTCATCCATCTCGAGATGGATGACTTCGATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080828.1-465s1c1
Sequence:CCGGGAGGAAGCTGTTTAAAGGGATCTCGAGATCCCTTTAAACAGCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159581    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080828.1-763s1c1
Sequence:CCGGCTTTGGATTTGGATCAGAATACTCGAGTATTCTGATCCAAATCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162226    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080828.1-777s1c1
Sequence:CCGGCAGAATAGCAAGGAAAGTGTTCTCGAGAACACTTTCCTTGCTATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080828.1-683s1c1
Sequence:CCGGCAGATGCTCTAAGTGATAAGACTCGAGTCTTATCACTTAGAGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163289    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080828.1-808s1c1
Sequence:CCGGGAAGGAGGATAATCAGACCAACTCGAGTTGGTCTGATTATCCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080828.1-678s1c1
Sequence:CCGGGACTTCAGATGCTCTAAGTGACTCGAGTCACTTAGAGCATCTGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080828
C20orf173 MISSION shRNA Lentiviral Transduction Particles
chromosome 20 open reading frame 173
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080828.1-450s1c1
Sequence:CCGGGCTTGGGAAATTGTGGAGGAACTCGAGTTCCTCCACAATTTCCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080828.1-673s1c1
Sequence:CCGGGTGTGGACTTCAGATGCTCTACTCGAGTAGAGCATCTGAAGTCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163503    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080828.1-866s1c1
Sequence:CCGGGCAGAAATCGAAGTCATCCATCTCGAGATGGATGACTTCGATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080828.1-465s1c1
Sequence:CCGGGAGGAAGCTGTTTAAAGGGATCTCGAGATCCCTTTAAACAGCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159581    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080828.1-763s1c1
Sequence:CCGGCTTTGGATTTGGATCAGAATACTCGAGTATTCTGATCCAAATCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162226    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080828.1-777s1c1
Sequence:CCGGCAGAATAGCAAGGAAAGTGTTCTCGAGAACACTTTCCTTGCTATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080828.1-683s1c1
Sequence:CCGGCAGATGCTCTAAGTGATAAGACTCGAGTCTTATCACTTAGAGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163289    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080828.1-808s1c1
Sequence:CCGGGAAGGAGGATAATCAGACCAACTCGAGTTGGTCTGATTATCCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080828.1-678s1c1
Sequence:CCGGGACTTCAGATGCTCTAAGTGACTCGAGTCACTTAGAGCATCTGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks