EMAIL THIS PAGE TO A FRIEND

C20orf194

chromosome 20 open reading frame 194

26 Gene Product Result for
Species: Human C20orf194(25943)
UniProtKB ID: Q5TEA3, Q66K86, Q6P2R9, Q9UFX9
Gene ID:
Human(25943) Summary: This gene encodes an uncharacterized protein with a C-terminal coiled-coil region. The gene is located on chromosome 20p13 in a 1.8 Mb region linked to a spinocerebellar ataxia phenotype, but this gene does not appear to be a disease candidate. [provided by RefSeq, Dec 2011]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001009984 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001009984 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001009984 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009984 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009984 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305753 predicted 2375
2 SASI_Hs02_00305754 predicted 2886
3 SASI_Hs02_00305755 predicted 1532
4 SASI_Hs02_00305756 predicted 3294
5 SASI_Hs02_00305757 predicted 1144
6 SASI_Hs02_00305758 predicted 1405
7 SASI_Hs02_00305759 predicted 917
8 SASI_Hs02_00305760 predicted 2841
9 SASI_Hs02_00305761 predicted 2117
10 SASI_Hs02_00305762 predicted 2003
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009984
VALIDATED
C20orf194 MISSION shRNA Bacterial Glycerol Stock
chromosome 20 open reading frame 194
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000268669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009984.1-2890s21c1
Sequence:CCGGATGCTACGATCTCGATATTTACTCGAGTAAATATCGAGATCGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001009984.1-768s21c1
Sequence:CCGGGACTAGCTTCTTCGCTAATTTCTCGAGAAATTAGCGAAGAAGCTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001009984.1-1153s21c1
Sequence:CCGGAGGCTATTGTCCCAGATATATCTCGAGATATATCTGGGACAATAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001009984.1-866s21c1
Sequence:CCGGGAATGATCTCTAGCCATATAACTCGAGTTATATGGCTAGAGATCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009984
VALIDATED
C20orf194 MISSION shRNA shRNA Plasmid DNA
chromosome 20 open reading frame 194
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000268669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009984.1-2890s21c1
Sequence:CCGGATGCTACGATCTCGATATTTACTCGAGTAAATATCGAGATCGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001009984.1-768s21c1
Sequence:CCGGGACTAGCTTCTTCGCTAATTTCTCGAGAAATTAGCGAAGAAGCTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001009984.1-1153s21c1
Sequence:CCGGAGGCTATTGTCCCAGATATATCTCGAGATATATCTGGGACAATAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001009984.1-866s21c1
Sequence:CCGGGAATGATCTCTAGCCATATAACTCGAGTTATATGGCTAGAGATCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009984
VALIDATED
C20orf194 MISSION shRNA Lentiviral Transduction Particles
chromosome 20 open reading frame 194
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000268669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009984.1-2890s21c1
Sequence:CCGGATGCTACGATCTCGATATTTACTCGAGTAAATATCGAGATCGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001009984.1-768s21c1
Sequence:CCGGGACTAGCTTCTTCGCTAATTTCTCGAGAAATTAGCGAAGAAGCTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001009984.1-1153s21c1
Sequence:CCGGAGGCTATTGTCCCAGATATATCTCGAGATATATCTGGGACAATAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001009984.1-866s21c1
Sequence:CCGGGAATGATCTCTAGCCATATAACTCGAGTTATATGGCTAGAGATCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks