EMAIL THIS PAGE TO A FRIEND

C20orf195

chromosome 20 open reading frame 195

18 Gene Product Result for
Species: Human C20orf195(79025)
UniProtKB ID: Q9BVV2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024059 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024059 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024059 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024059 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024059 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114936 predicted 694
2 SASI_Hs01_00114937 predicted 303
3 SASI_Hs01_00114938 predicted 682
4 SASI_Hs01_00114939 predicted 300
5 SASI_Hs01_00114940 predicted 291
6 SASI_Hs01_00114941 predicted 199
7 SASI_Hs01_00114942 predicted 402
8 SASI_Hs01_00114943 predicted 223
9 SASI_Hs01_00114944 predicted 701
10 SASI_Hs01_00114945 predicted 711
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024059
C20orf195 MISSION shRNA Bacterial Glycerol Stock
chromosome 20 open reading frame 195
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024059.2-124s21c1
Sequence:CCGGACAAGATGAAGCTGGGCAATCCTCGAGGATTGCCCAGCTTCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024059.2-602s21c1
Sequence:CCGGGGACAGCTTCCTGACCATGATCTCGAGATCATGGTCAGGAAGCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024059.2-798s21c1
Sequence:CCGGACATCGGAGCAGTATGAGTTGCTCGAGCAACTCATACTGCTCCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024059.2-303s21c1
Sequence:CCGGCTGCGTAAGTGCTCCTACTACCTCGAGGTAGTAGGAGCACTTACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024059.2-408s21c1
Sequence:CCGGTGGAAGTTCCAGCGCATGAAGCTCGAGCTTCATGCGCTGGAACTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024059.2-717s21c1
Sequence:CCGGCCTGTCGTGTTTGACCGAAAGCTCGAGCTTTCGGTCAAACACGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024059.2-663s21c1
Sequence:CCGGGATGTCAGTGCCACCAAGATCCTCGAGGATCTTGGTGGCACTGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024059.2-305s1c1
Sequence:CCGGGCGTAAGTGCTCCTACTACATCTCGAGATGTAGTAGGAGCACTTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024059.2-797s1c1
Sequence:CCGGCACATCGGAGCAGTATGAGTTCTCGAGAACTCATACTGCTCCGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024059
C20orf195 MISSION shRNA shRNA Plasmid DNA
chromosome 20 open reading frame 195
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024059.2-124s21c1
Sequence:CCGGACAAGATGAAGCTGGGCAATCCTCGAGGATTGCCCAGCTTCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024059.2-602s21c1
Sequence:CCGGGGACAGCTTCCTGACCATGATCTCGAGATCATGGTCAGGAAGCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024059.2-798s21c1
Sequence:CCGGACATCGGAGCAGTATGAGTTGCTCGAGCAACTCATACTGCTCCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024059.2-303s21c1
Sequence:CCGGCTGCGTAAGTGCTCCTACTACCTCGAGGTAGTAGGAGCACTTACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024059.2-408s21c1
Sequence:CCGGTGGAAGTTCCAGCGCATGAAGCTCGAGCTTCATGCGCTGGAACTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024059.2-717s21c1
Sequence:CCGGCCTGTCGTGTTTGACCGAAAGCTCGAGCTTTCGGTCAAACACGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024059.2-663s21c1
Sequence:CCGGGATGTCAGTGCCACCAAGATCCTCGAGGATCTTGGTGGCACTGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024059.2-305s1c1
Sequence:CCGGGCGTAAGTGCTCCTACTACATCTCGAGATGTAGTAGGAGCACTTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024059.2-797s1c1
Sequence:CCGGCACATCGGAGCAGTATGAGTTCTCGAGAACTCATACTGCTCCGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024059
C20orf195 MISSION shRNA Lentiviral Transduction Particles
chromosome 20 open reading frame 195
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024059.2-124s21c1
Sequence:CCGGACAAGATGAAGCTGGGCAATCCTCGAGGATTGCCCAGCTTCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024059.2-602s21c1
Sequence:CCGGGGACAGCTTCCTGACCATGATCTCGAGATCATGGTCAGGAAGCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024059.2-798s21c1
Sequence:CCGGACATCGGAGCAGTATGAGTTGCTCGAGCAACTCATACTGCTCCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024059.2-303s21c1
Sequence:CCGGCTGCGTAAGTGCTCCTACTACCTCGAGGTAGTAGGAGCACTTACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024059.2-408s21c1
Sequence:CCGGTGGAAGTTCCAGCGCATGAAGCTCGAGCTTCATGCGCTGGAACTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024059.2-717s21c1
Sequence:CCGGCCTGTCGTGTTTGACCGAAAGCTCGAGCTTTCGGTCAAACACGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024059.2-663s21c1
Sequence:CCGGGATGTCAGTGCCACCAAGATCCTCGAGGATCTTGGTGGCACTGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024059.2-305s1c1
Sequence:CCGGGCGTAAGTGCTCCTACTACATCTCGAGATGTAGTAGGAGCACTTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024059.2-797s1c1
Sequence:CCGGCACATCGGAGCAGTATGAGTTCTCGAGAACTCATACTGCTCCGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks