EMAIL THIS PAGE TO A FRIEND

C20orf196

chromosome 20 open reading frame 196

23 Gene Product Result for
Species: Human C20orf196(149840)
UniProtKB ID: Q8IYI0, A8K9J3, Q5TGA9, Q96LU1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152504 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152504 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152504 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU097071 MISSION® esiRNA esiRNA human C20orf196 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152504 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152504 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102807 predicted 448
2 SASI_Hs01_00102808 predicted 370
3 SASI_Hs01_00102809 predicted 327
4 SASI_Hs01_00102810 predicted 314
5 SASI_Hs01_00102811 predicted 359
6 SASI_Hs01_00102812 predicted 258
7 SASI_Hs01_00102813 predicted 362
8 SASI_Hs01_00102814 predicted 532
9 SASI_Hs01_00102815 predicted 306
10 SASI_Hs01_00102816 predicted 376
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152504
VALIDATED
C20orf196 MISSION shRNA Bacterial Glycerol Stock
chromosome 20 open reading frame 196
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_152504.2-643s1c1
Sequence:CCGGCCAGGACTGTCAAAGGATATTCTCGAGAATATCCTTTGACAGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152504.2-681s1c1
Sequence:CCGGGCAGAATGTAATGAAAGACCTCTCGAGAGGTCTTTCATTACATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133964    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_152504.2-810s1c1
Sequence:CCGGCCAATCCCAATTAAGTGCTTTCTCGAGAAAGCACTTAATTGGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_152504.2-816s1c1
Sequence:CCGGCCAATTAAGTGCTTTGAGGTTCTCGAGAACCTCAAAGCACTTAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152504.2-208s1c1
Sequence:CCGGGAGGCTTTCAGTTCTTTGGAACTCGAGTTCCAAAGAACTGAAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152504.2-259s1c1
Sequence:CCGGGATCCAGACACCAGTAACTTACTCGAGTAAGTTACTGGTGTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152504.2-560s21c1
Sequence:CCGGCCGTCTTACAGAGGCATTCCACTCGAGTGGAATGCCTCTGTAAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152504.2-383s21c1
Sequence:CCGGTGGATAGATTCTATGAAATGTCTCGAGACATTTCATAGAATCTATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152504.2-333s21c1
Sequence:CCGGTGTGAAAGGCCAGTCAGAGAACTCGAGTTCTCTGACTGGCCTTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152504.2-153s21c1
Sequence:CCGGAGCGTGTGACATAAGAGATTACTCGAGTAATCTCTTATGTCACACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152504.2-359s21c1
Sequence:CCGGAGGATGATGGCCTTCGGAAATCTCGAGATTTCCGAAGGCCATCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152504.2-428s21c1
Sequence:CCGGCAAACTCACTCTCTGCATCTGCTCGAGCAGATGCAGAGAGTGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152504.2-119s21c1
Sequence:CCGGTGTCAGAGGAGAGCAGTGCTTCTCGAGAAGCACTGCTCTCCTCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152504
VALIDATED
C20orf196 MISSION shRNA shRNA Plasmid DNA
chromosome 20 open reading frame 196
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_152504.2-643s1c1
Sequence:CCGGCCAGGACTGTCAAAGGATATTCTCGAGAATATCCTTTGACAGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152504.2-681s1c1
Sequence:CCGGGCAGAATGTAATGAAAGACCTCTCGAGAGGTCTTTCATTACATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133964    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_152504.2-810s1c1
Sequence:CCGGCCAATCCCAATTAAGTGCTTTCTCGAGAAAGCACTTAATTGGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_152504.2-816s1c1
Sequence:CCGGCCAATTAAGTGCTTTGAGGTTCTCGAGAACCTCAAAGCACTTAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152504.2-208s1c1
Sequence:CCGGGAGGCTTTCAGTTCTTTGGAACTCGAGTTCCAAAGAACTGAAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152504.2-259s1c1
Sequence:CCGGGATCCAGACACCAGTAACTTACTCGAGTAAGTTACTGGTGTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152504.2-560s21c1
Sequence:CCGGCCGTCTTACAGAGGCATTCCACTCGAGTGGAATGCCTCTGTAAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152504.2-383s21c1
Sequence:CCGGTGGATAGATTCTATGAAATGTCTCGAGACATTTCATAGAATCTATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152504.2-333s21c1
Sequence:CCGGTGTGAAAGGCCAGTCAGAGAACTCGAGTTCTCTGACTGGCCTTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152504.2-153s21c1
Sequence:CCGGAGCGTGTGACATAAGAGATTACTCGAGTAATCTCTTATGTCACACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152504.2-359s21c1
Sequence:CCGGAGGATGATGGCCTTCGGAAATCTCGAGATTTCCGAAGGCCATCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152504.2-428s21c1
Sequence:CCGGCAAACTCACTCTCTGCATCTGCTCGAGCAGATGCAGAGAGTGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152504.2-119s21c1
Sequence:CCGGTGTCAGAGGAGAGCAGTGCTTCTCGAGAAGCACTGCTCTCCTCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152504
VALIDATED
C20orf196 MISSION shRNA Lentiviral Transduction Particles
chromosome 20 open reading frame 196
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_152504.2-643s1c1
Sequence:CCGGCCAGGACTGTCAAAGGATATTCTCGAGAATATCCTTTGACAGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152504.2-681s1c1
Sequence:CCGGGCAGAATGTAATGAAAGACCTCTCGAGAGGTCTTTCATTACATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133964    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_152504.2-810s1c1
Sequence:CCGGCCAATCCCAATTAAGTGCTTTCTCGAGAAAGCACTTAATTGGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_152504.2-816s1c1
Sequence:CCGGCCAATTAAGTGCTTTGAGGTTCTCGAGAACCTCAAAGCACTTAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152504.2-208s1c1
Sequence:CCGGGAGGCTTTCAGTTCTTTGGAACTCGAGTTCCAAAGAACTGAAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152504.2-259s1c1
Sequence:CCGGGATCCAGACACCAGTAACTTACTCGAGTAAGTTACTGGTGTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152504.2-560s21c1
Sequence:CCGGCCGTCTTACAGAGGCATTCCACTCGAGTGGAATGCCTCTGTAAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152504.2-383s21c1
Sequence:CCGGTGGATAGATTCTATGAAATGTCTCGAGACATTTCATAGAATCTATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152504.2-333s21c1
Sequence:CCGGTGTGAAAGGCCAGTCAGAGAACTCGAGTTCTCTGACTGGCCTTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152504.2-153s21c1
Sequence:CCGGAGCGTGTGACATAAGAGATTACTCGAGTAATCTCTTATGTCACACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152504.2-359s21c1
Sequence:CCGGAGGATGATGGCCTTCGGAAATCTCGAGATTTCCGAAGGCCATCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152504.2-428s21c1
Sequence:CCGGCAAACTCACTCTCTGCATCTGCTCGAGCAGATGCAGAGAGTGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152504.2-119s21c1
Sequence:CCGGTGTCAGAGGAGAGCAGTGCTTCTCGAGAAGCACTGCTCTCCTCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks