EMAIL THIS PAGE TO A FRIEND

C20orf197

chromosome 20 open reading frame 197

19 Gene Product Result for
Synonyms: RP5-1017F8.1
Species: Human C20orf197(284756)
UniProtKB ID: Q8N268, Q08EQ0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173644 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173644 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173644 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU044101 MISSION® esiRNA esiRNA human C20orf197 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173644 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146506 predicted 323
2 SASI_Hs01_00146507 predicted 321
3 SASI_Hs01_00146508 predicted 1100
4 SASI_Hs01_00146509 predicted 967
5 SASI_Hs01_00146510 predicted 1966
6 SASI_Hs01_00146511 predicted 1740
7 SASI_Hs02_00368545 predicted 1746
8 SASI_Hs01_00146512 predicted 1210
9 SASI_Hs01_00146513 predicted 2010
10 SASI_Hs01_00146514 predicted 2001
11 SASI_Hs01_00146515 predicted 2646
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173644
C20orf197 MISSION shRNA Bacterial Glycerol Stock
chromosome 20 open reading frame 197
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173644.1-574s21c1
Sequence:CCGGACAATGTGCATTTGGGTATTACTCGAGTAATACCCAAATGCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173644.1-637s21c1
Sequence:CCGGCTTGATCCAATGCCATGTTTCCTCGAGGAAACATGGCATTGGATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173644.1-1838s21c1
Sequence:CCGGTCCCAACTTATGATTACTTAACTCGAGTTAAGTAATCATAAGTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173644.1-675s21c1
Sequence:CCGGTGGGACACCTTAGTCCATAACCTCGAGGTTATGGACTAAGGTGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173644.1-575s1c1
Sequence:CCGGCAATGTGCATTTGGGTATTAACTCGAGTTAATACCCAAATGCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173644
C20orf197 MISSION shRNA shRNA Plasmid DNA
chromosome 20 open reading frame 197
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173644.1-574s21c1
Sequence:CCGGACAATGTGCATTTGGGTATTACTCGAGTAATACCCAAATGCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173644.1-637s21c1
Sequence:CCGGCTTGATCCAATGCCATGTTTCCTCGAGGAAACATGGCATTGGATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173644.1-1838s21c1
Sequence:CCGGTCCCAACTTATGATTACTTAACTCGAGTTAAGTAATCATAAGTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173644.1-675s21c1
Sequence:CCGGTGGGACACCTTAGTCCATAACCTCGAGGTTATGGACTAAGGTGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173644.1-575s1c1
Sequence:CCGGCAATGTGCATTTGGGTATTAACTCGAGTTAATACCCAAATGCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173644
C20orf197 MISSION shRNA Lentiviral Transduction Particles
chromosome 20 open reading frame 197
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173644.1-574s21c1
Sequence:CCGGACAATGTGCATTTGGGTATTACTCGAGTAATACCCAAATGCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173644.1-637s21c1
Sequence:CCGGCTTGATCCAATGCCATGTTTCCTCGAGGAAACATGGCATTGGATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173644.1-1838s21c1
Sequence:CCGGTCCCAACTTATGATTACTTAACTCGAGTTAAGTAATCATAAGTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173644.1-675s21c1
Sequence:CCGGTGGGACACCTTAGTCCATAACCTCGAGGTTATGGACTAAGGTGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173644.1-575s1c1
Sequence:CCGGCAATGTGCATTTGGGTATTAACTCGAGTTAATACCCAAATGCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks