EMAIL THIS PAGE TO A FRIEND

C20orf201

chromosome 20 open reading frame 201

17 Gene Product Result for
Species: Human C20orf201(198437)
UniProtKB ID: Q8TD35, Q8N419, Q8TD36
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001007125 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007125 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007125 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007125 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007125 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128171 predicted 529
2 SASI_Hs01_00128172 predicted 320
3 SASI_Hs01_00128174 predicted 534
4 SASI_Hs01_00128175 predicted 413
5 SASI_Hs01_00128176 predicted 280
6 SASI_Hs01_00128177 predicted 280
7 SASI_Hs02_00305230 predicted 197
8 SASI_Hs01_00128178 predicted 199
9 SASI_Hs01_00128179 predicted 524
10 SASI_Hs01_00128180 predicted 542
11 SASI_Hs01_00128173 predicted 559
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007125
C20orf201 MISSION shRNA Bacterial Glycerol Stock
chromosome 20 open reading frame 201
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000283948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007125.1-324s21c1
Sequence:CCGGCATCTGCTCTTCGGCGACCTGCTCGAGCAGGTCGCCGAAGAGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007125.1-655s21c1
Sequence:CCGGACCGCCAAGAGGTGCAGACAACTCGAGTTGTCTGCACCTCTTGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007125.1-375s21c1
Sequence:CCGGTTCCCGTGCGGGTCGGTGGAACTCGAGTTCCACCGACCCGCACGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007125.1-559s21c1
Sequence:CCGGTGCTCATCCAGCGGCAGAAGTCTCGAGACTTCTGCCGCTGGATGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007125
C20orf201 MISSION shRNA shRNA Plasmid DNA
chromosome 20 open reading frame 201
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000283948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007125.1-324s21c1
Sequence:CCGGCATCTGCTCTTCGGCGACCTGCTCGAGCAGGTCGCCGAAGAGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007125.1-655s21c1
Sequence:CCGGACCGCCAAGAGGTGCAGACAACTCGAGTTGTCTGCACCTCTTGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007125.1-375s21c1
Sequence:CCGGTTCCCGTGCGGGTCGGTGGAACTCGAGTTCCACCGACCCGCACGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007125.1-559s21c1
Sequence:CCGGTGCTCATCCAGCGGCAGAAGTCTCGAGACTTCTGCCGCTGGATGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007125
C20orf201 MISSION shRNA Lentiviral Transduction Particles
chromosome 20 open reading frame 201
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000283948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007125.1-324s21c1
Sequence:CCGGCATCTGCTCTTCGGCGACCTGCTCGAGCAGGTCGCCGAAGAGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007125.1-655s21c1
Sequence:CCGGACCGCCAAGAGGTGCAGACAACTCGAGTTGTCTGCACCTCTTGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007125.1-375s21c1
Sequence:CCGGTTCCCGTGCGGGTCGGTGGAACTCGAGTTCCACCGACCCGCACGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007125.1-559s21c1
Sequence:CCGGTGCTCATCCAGCGGCAGAAGTCTCGAGACTTCTGCCGCTGGATGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks