EMAIL THIS PAGE TO A FRIEND

C20orf203

chromosome 20 open reading frame 203

33 Gene Product Result for
Species: Human C20orf203(284805)
UniProtKB ID: Q8NBC4, B8JHY2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100826 Anti-FLJ33706 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182584 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182584 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182584 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_041128 Rosetta Predictions human pricing
XR_041129 Rosetta Predictions human pricing
XR_041130 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041128 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00524885 predicted 1078
2 SASI_Hs02_00524886 predicted 764
3 SASI_Hs02_00524887 predicted 1117
4 SASI_Hs02_00524888 predicted 1116
5 SASI_Hs02_00524889 predicted 708
6 SASI_Hs02_00524890 predicted 234
7 SASI_Hs02_00524891 predicted 1079
8 SASI_Hs02_00524892 predicted 824
9 SASI_Hs02_00524893 predicted 1102
10 SASI_Hs02_00524894 predicted 1109
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041129 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00524895 predicted 1087
2 SASI_Hs02_00524896 predicted 769
3 SASI_Hs02_00524897 predicted 1110
4 SASI_Hs02_00524898 predicted 1116
5 SASI_Hs02_00524899 predicted 703
6 SASI_Hs02_00524900 predicted 243
7 SASI_Hs02_00524901 predicted 1086
8 SASI_Hs02_00524902 predicted 831
9 SASI_Hs02_00524903 predicted 1101
10 SASI_Hs02_00524904 predicted 1109
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041130 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00524905 predicted 1082
2 SASI_Hs02_00524906 predicted 769
3 SASI_Hs02_00524907 predicted 1111
4 SASI_Hs02_00524908 predicted 1120
5 SASI_Hs02_00524909 predicted 706
6 SASI_Hs02_00524910 predicted 238
7 SASI_Hs02_00524911 predicted 1078
8 SASI_Hs02_00524912 predicted 833
9 SASI_Hs02_00524913 predicted 1095
10 SASI_Hs02_00524914 predicted 1109
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182584
C20orf203 MISSION shRNA Bacterial Glycerol Stock
chromosome 20 open reading frame 203
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000141669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182584.1-1375s1c1
Sequence:CCGGCCCTTCTGTTTCCCTGAAGAACTCGAGTTCTTCAGGGAAACAGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182584.1-718s1c1
Sequence:CCGGCAATTCATCACGGTCGCTGTTCTCGAGAACAGCGACCGTGATGAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167387    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182584.1-2275s1c1
Sequence:CCGGGCTCATTTCAATTTCAGTCAACTCGAGTTGACTGAAATTGAAATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182584.1-682s1c1
Sequence:CCGGGCCTGCACCTTTAATTAGCAACTCGAGTTGCTAATTAAAGGTGCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182584.1-690s1c1
Sequence:CCGGCTTTAATTAGCAAGCAGCAGTCTCGAGACTGCTGCTTGCTAATTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182584
C20orf203 MISSION shRNA shRNA Plasmid DNA
chromosome 20 open reading frame 203
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000141669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182584.1-1375s1c1
Sequence:CCGGCCCTTCTGTTTCCCTGAAGAACTCGAGTTCTTCAGGGAAACAGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182584.1-718s1c1
Sequence:CCGGCAATTCATCACGGTCGCTGTTCTCGAGAACAGCGACCGTGATGAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167387    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182584.1-2275s1c1
Sequence:CCGGGCTCATTTCAATTTCAGTCAACTCGAGTTGACTGAAATTGAAATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182584.1-682s1c1
Sequence:CCGGGCCTGCACCTTTAATTAGCAACTCGAGTTGCTAATTAAAGGTGCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182584.1-690s1c1
Sequence:CCGGCTTTAATTAGCAAGCAGCAGTCTCGAGACTGCTGCTTGCTAATTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182584
C20orf203 MISSION shRNA Lentiviral Transduction Particles
chromosome 20 open reading frame 203
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000141669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182584.1-1375s1c1
Sequence:CCGGCCCTTCTGTTTCCCTGAAGAACTCGAGTTCTTCAGGGAAACAGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182584.1-718s1c1
Sequence:CCGGCAATTCATCACGGTCGCTGTTCTCGAGAACAGCGACCGTGATGAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167387    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182584.1-2275s1c1
Sequence:CCGGGCTCATTTCAATTTCAGTCAACTCGAGTTGACTGAAATTGAAATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182584.1-682s1c1
Sequence:CCGGGCCTGCACCTTTAATTAGCAACTCGAGTTGCTAATTAAAGGTGCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182584.1-690s1c1
Sequence:CCGGCTTTAATTAGCAAGCAGCAGTCTCGAGACTGCTGCTTGCTAATTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)