EMAIL THIS PAGE TO A FRIEND

C20orf24

chromosome 20 open reading frame 24

86 Gene Product Result for
Synonyms: RIP5
Gene ID:
Zebrafish(334006) c20orf24 homolog (H. sapiens)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA057387 Anti-C20orf24 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2108059 Anti-C20ORF24 antibody produced in rabbit IgG fraction of antiserum mouse, yeast, rat, canine, guinea pig, bovine, horse, rabbit, human
western blot pricing
AV49339 Anti-C20ORF24 antibody produced in rabbit IgG fraction of antiserum, lyophilized powder rat, yeast, canine, bovine, mouse, rabbit, human, horse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018840 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018840 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018840 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078211 MISSION® esiRNA esiRNA human C20orf24 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018840 Rosetta Predictions human pricing
NM_199483 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018840 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352292 predicted 858
2 SASI_Hs01_00206387 predicted 851
3 SASI_Hs01_00206388 predicted 851
4 SASI_Hs02_00352293 predicted 843
5 SASI_Hs01_00206392 predicted 853
6 SASI_Hs02_00352294 predicted 854
7 SASI_Hs01_00206384 predicted 727
8 SASI_Hs01_00206385 predicted 794
9 SASI_Hs01_00206386 predicted 819
10 SASI_Hs01_00206389 predicted 837
11 SASI_Hs01_00206390 predicted 810
12 SASI_Hs01_00206391 predicted 799
13 SASI_Hs01_00206393 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372877 predicted 727
2 SASI_Hs01_00173228 predicted 724
3 SASI_Hs01_00173229 predicted 727
4 SASI_Hs01_00173233 predicted 720
5 SASI_Hs01_00173234 predicted 717
6 SASI_Hs02_00372878 predicted 719
7 SASI_Hs01_00173226 predicted 670
8 SASI_Hs01_00173227 predicted 686
9 SASI_Hs01_00173230 predicted 708
10 SASI_Hs01_00173231 predicted 666
11 SASI_Hs01_00173232 predicted 663
12 SASI_Hs01_00173235 predicted 680
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018840
VALIDATED
C20orf24 MISSION shRNA Bacterial Glycerol Stock
chromosome 20 open reading frame 24
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018840.2-248s1c1
Sequence:CCGGCAAAGTCTCCGTCTGGAGTAACTCGAGTTACTCCAGACGGAGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018840.2-443s1c1
Sequence:CCGGCTTCAGCAATTACCTACAGATCTCGAGATCTGTAGGTAATTGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018840.2-876s1c1
Sequence:CCGGGCACCTCTGGATTCAGATGAACTCGAGTTCATCTGAATCCAGAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018840.2-808s1c1
Sequence:CCGGCCATTTCTTCTTGGATACCATCTCGAGATGGTATCCAAGAAGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183748    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018840.2-825s1c1
Sequence:CCGGCCATCAAGTAACAGCTATTATCTCGAGATAATAGCTGTTACTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018840.2-434s1c1
Sequence:CCGGGTACCTCTACTTCAGCAATTACTCGAGTAATTGCTGAAGTAGAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018840.2-248s21c1
Sequence:CCGGCAAAGTCTCCGTCTGGAGTAACTCGAGTTACTCCAGACGGAGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018840.2-443s21c1
Sequence:CCGGCTTCAGCAATTACCTACAGATCTCGAGATCTGTAGGTAATTGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018840.2-403s21c1
Sequence:CCGGCAGGATTCTGCCTGATCAATGCTCGAGCATTGATCAGGCAGAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018840.2-876s21c1
Sequence:CCGGGCACCTCTGGATTCAGATGAACTCGAGTTCATCTGAATCCAGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018840.2-553s21c1
Sequence:CCGGTTTACACTGCCATCCATTATGCTCGAGCATAATGGATGGCAGTGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018840
VALIDATED
C20orf24 MISSION shRNA shRNA Plasmid DNA
chromosome 20 open reading frame 24
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018840.2-248s1c1
Sequence:CCGGCAAAGTCTCCGTCTGGAGTAACTCGAGTTACTCCAGACGGAGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018840.2-443s1c1
Sequence:CCGGCTTCAGCAATTACCTACAGATCTCGAGATCTGTAGGTAATTGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018840.2-876s1c1
Sequence:CCGGGCACCTCTGGATTCAGATGAACTCGAGTTCATCTGAATCCAGAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018840.2-808s1c1
Sequence:CCGGCCATTTCTTCTTGGATACCATCTCGAGATGGTATCCAAGAAGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183748    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018840.2-825s1c1
Sequence:CCGGCCATCAAGTAACAGCTATTATCTCGAGATAATAGCTGTTACTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018840.2-434s1c1
Sequence:CCGGGTACCTCTACTTCAGCAATTACTCGAGTAATTGCTGAAGTAGAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018840.2-248s21c1
Sequence:CCGGCAAAGTCTCCGTCTGGAGTAACTCGAGTTACTCCAGACGGAGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018840.2-443s21c1
Sequence:CCGGCTTCAGCAATTACCTACAGATCTCGAGATCTGTAGGTAATTGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018840.2-403s21c1
Sequence:CCGGCAGGATTCTGCCTGATCAATGCTCGAGCATTGATCAGGCAGAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018840.2-876s21c1
Sequence:CCGGGCACCTCTGGATTCAGATGAACTCGAGTTCATCTGAATCCAGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018840.2-553s21c1
Sequence:CCGGTTTACACTGCCATCCATTATGCTCGAGCATAATGGATGGCAGTGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018840
VALIDATED
C20orf24 MISSION shRNA Lentiviral Transduction Particles
chromosome 20 open reading frame 24
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018840.2-248s1c1
Sequence:CCGGCAAAGTCTCCGTCTGGAGTAACTCGAGTTACTCCAGACGGAGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018840.2-443s1c1
Sequence:CCGGCTTCAGCAATTACCTACAGATCTCGAGATCTGTAGGTAATTGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018840.2-876s1c1
Sequence:CCGGGCACCTCTGGATTCAGATGAACTCGAGTTCATCTGAATCCAGAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018840.2-808s1c1
Sequence:CCGGCCATTTCTTCTTGGATACCATCTCGAGATGGTATCCAAGAAGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183748    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018840.2-825s1c1
Sequence:CCGGCCATCAAGTAACAGCTATTATCTCGAGATAATAGCTGTTACTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018840.2-434s1c1
Sequence:CCGGGTACCTCTACTTCAGCAATTACTCGAGTAATTGCTGAAGTAGAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018840.2-248s21c1
Sequence:CCGGCAAAGTCTCCGTCTGGAGTAACTCGAGTTACTCCAGACGGAGACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018840.2-443s21c1
Sequence:CCGGCTTCAGCAATTACCTACAGATCTCGAGATCTGTAGGTAATTGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018840.2-403s21c1
Sequence:CCGGCAGGATTCTGCCTGATCAATGCTCGAGCATTGATCAGGCAGAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018840.2-876s21c1
Sequence:CCGGGCACCTCTGGATTCAGATGAACTCGAGTTCATCTGAATCCAGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018840.2-553s21c1
Sequence:CCGGTTTACACTGCCATCCATTATGCTCGAGCATAATGGATGGCAGTGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks