EMAIL THIS PAGE TO A FRIEND

C20orf26

chromosome 20 open reading frame 26

36 Gene Product Result for
Synonyms: dJ1002M8.3 dJ1178H5.4
Species: Human C20orf26(26074)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015585 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015585 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015585 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU098071 MISSION® esiRNA esiRNA human C20orf26 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015585 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015585 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102195 predicted 234
2 SASI_Hs02_00348170 predicted 1314
3 SASI_Hs01_00102196 predicted 3031
4 SASI_Hs01_00102197 predicted 3095
5 SASI_Hs01_00102201 predicted 1482
6 SASI_Hs01_00102202 predicted 3141
7 SASI_Hs02_00348171 predicted 2002
8 SASI_Hs02_00348172 predicted 2276
9 SASI_Hs01_00102204 predicted 902
10 SASI_Hs02_00348173 predicted 751
11 SASI_Hs01_00102198 predicted 2912
12 SASI_Hs01_00102199 predicted 1812
13 SASI_Hs01_00102200 predicted 2443
14 SASI_Hs01_00102203 predicted 1638
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015585
C20orf26 MISSION shRNA Bacterial Glycerol Stock
chromosome 20 open reading frame 26
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015585.3-2938s21c1
Sequence:CCGGGTGGATTATGAAACGTTTAAACTCGAGTTTAAACGTTTCATAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015585.3-753s21c1
Sequence:CCGGATACTTCCTGGCCGAACTAATCTCGAGATTAGTTCGGCCAGGAAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015585.3-476s21c1
Sequence:CCGGAGATTCTTCGAACCGTGTATACTCGAGTATACACGGTTCGAAGAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015585.3-1489s21c1
Sequence:CCGGGGATTGCTCAAGTCCATTAATCTCGAGATTAATGGACTTGAGCAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015585.3-694s21c1
Sequence:CCGGGACGATCTCATGCCAATATTTCTCGAGAAATATTGGCATGAGATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015585.2-679s1c1
Sequence:CCGGGCGCTATGACACAATTCTGAACTCGAGTTCAGAATTGTGTCATAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015585.2-1682s1c1
Sequence:CCGGCGGTCCCATTACAACATTGAACTCGAGTTCAATGTTGTAATGGGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015585.2-3101s1c1
Sequence:CCGGGCTATGCTACATCTCTTTGATCTCGAGATCAAAGAGATGTAGCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015585.2-2136s1c1
Sequence:CCGGGCTCTCACATGAAGTTTAATACTCGAGTATTAAACTTCATGTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015585
C20orf26 MISSION shRNA shRNA Plasmid DNA
chromosome 20 open reading frame 26
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015585.3-2938s21c1
Sequence:CCGGGTGGATTATGAAACGTTTAAACTCGAGTTTAAACGTTTCATAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015585.3-753s21c1
Sequence:CCGGATACTTCCTGGCCGAACTAATCTCGAGATTAGTTCGGCCAGGAAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015585.3-476s21c1
Sequence:CCGGAGATTCTTCGAACCGTGTATACTCGAGTATACACGGTTCGAAGAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015585.3-1489s21c1
Sequence:CCGGGGATTGCTCAAGTCCATTAATCTCGAGATTAATGGACTTGAGCAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015585.3-694s21c1
Sequence:CCGGGACGATCTCATGCCAATATTTCTCGAGAAATATTGGCATGAGATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015585.2-679s1c1
Sequence:CCGGGCGCTATGACACAATTCTGAACTCGAGTTCAGAATTGTGTCATAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015585.2-1682s1c1
Sequence:CCGGCGGTCCCATTACAACATTGAACTCGAGTTCAATGTTGTAATGGGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015585.2-3101s1c1
Sequence:CCGGGCTATGCTACATCTCTTTGATCTCGAGATCAAAGAGATGTAGCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015585.2-2136s1c1
Sequence:CCGGGCTCTCACATGAAGTTTAATACTCGAGTATTAAACTTCATGTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015585
C20orf26 MISSION shRNA Lentiviral Transduction Particles
chromosome 20 open reading frame 26
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015585.3-2938s21c1
Sequence:CCGGGTGGATTATGAAACGTTTAAACTCGAGTTTAAACGTTTCATAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015585.3-753s21c1
Sequence:CCGGATACTTCCTGGCCGAACTAATCTCGAGATTAGTTCGGCCAGGAAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015585.3-476s21c1
Sequence:CCGGAGATTCTTCGAACCGTGTATACTCGAGTATACACGGTTCGAAGAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015585.3-1489s21c1
Sequence:CCGGGGATTGCTCAAGTCCATTAATCTCGAGATTAATGGACTTGAGCAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015585.3-694s21c1
Sequence:CCGGGACGATCTCATGCCAATATTTCTCGAGAAATATTGGCATGAGATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015585.2-679s1c1
Sequence:CCGGGCGCTATGACACAATTCTGAACTCGAGTTCAGAATTGTGTCATAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015585.2-1682s1c1
Sequence:CCGGCGGTCCCATTACAACATTGAACTCGAGTTCAATGTTGTAATGGGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015585.2-3101s1c1
Sequence:CCGGGCTATGCTACATCTCTTTGATCTCGAGATCAAAGAGATGTAGCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015585.2-2136s1c1
Sequence:CCGGGCTCTCACATGAAGTTTAATACTCGAGTATTAAACTTCATGTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks