EMAIL THIS PAGE TO A FRIEND

C20orf27

chromosome 20 open reading frame 27

102 Gene Product Result for
Species: Human C20orf27(54976)
UniProtKB ID: Q9GZN8, A8K4J0, D3DVX8, Q5JX81, Q9NWX3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039140 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039140 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039140 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU084621 MISSION® esiRNA esiRNA human C20orf27 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039140 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039140 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123039 predicted 628
2 SASI_Hs01_00123040 predicted 308
3 SASI_Hs01_00123041 predicted 245
4 SASI_Hs01_00123042 predicted 751
5 SASI_Hs01_00123043 predicted 745
6 SASI_Hs01_00123045 predicted 630
7 SASI_Hs01_00123046 predicted 259
8 SASI_Hs02_00308436 predicted 535
9 SASI_Hs01_00123047 predicted 630
10 SASI_Hs01_00123048 predicted 349
11 SASI_Hs01_00123044 predicted 263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039140
C20orf27 MISSION shRNA Bacterial Glycerol Stock
chromosome 20 open reading frame 27
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039140.1-483s21c1
Sequence:CCGGTCCTGCACAGGTATGAGATTACTCGAGTAATCTCATACCTGTGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039140.1-1058s21c1
Sequence:CCGGGAAATGGGTTGAGCCCGAAAGCTCGAGCTTTCGGGCTCAACCCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039140.1-593s21c1
Sequence:CCGGCCCGTCCCTGAAGGTTATAGTCTCGAGACTATAACCTTCAGGGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039140.1-620s21c1
Sequence:CCGGTGTGAGTACTCGGCGCACAAACTCGAGTTTGTGCGCCGAGTACTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039140.1-645s21c1
Sequence:CCGGGCGTCCTCAAAGAGGAGATACCTCGAGGTATCTCCTCTTTGAGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039140
C20orf27 MISSION shRNA shRNA Plasmid DNA
chromosome 20 open reading frame 27
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039140.1-483s21c1
Sequence:CCGGTCCTGCACAGGTATGAGATTACTCGAGTAATCTCATACCTGTGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039140.1-1058s21c1
Sequence:CCGGGAAATGGGTTGAGCCCGAAAGCTCGAGCTTTCGGGCTCAACCCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039140.1-593s21c1
Sequence:CCGGCCCGTCCCTGAAGGTTATAGTCTCGAGACTATAACCTTCAGGGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039140.1-620s21c1
Sequence:CCGGTGTGAGTACTCGGCGCACAAACTCGAGTTTGTGCGCCGAGTACTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039140.1-645s21c1
Sequence:CCGGGCGTCCTCAAAGAGGAGATACCTCGAGGTATCTCCTCTTTGAGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039140
C20orf27 MISSION shRNA Lentiviral Transduction Particles
chromosome 20 open reading frame 27
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039140.1-483s21c1
Sequence:CCGGTCCTGCACAGGTATGAGATTACTCGAGTAATCTCATACCTGTGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039140.1-1058s21c1
Sequence:CCGGGAAATGGGTTGAGCCCGAAAGCTCGAGCTTTCGGGCTCAACCCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039140.1-593s21c1
Sequence:CCGGCCCGTCCCTGAAGGTTATAGTCTCGAGACTATAACCTTCAGGGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039140.1-620s21c1
Sequence:CCGGTGTGAGTACTCGGCGCACAAACTCGAGTTTGTGCGCCGAGTACTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039140.1-645s21c1
Sequence:CCGGGCGTCCTCAAAGAGGAGATACCTCGAGGTATCTCCTCTTTGAGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks