EMAIL THIS PAGE TO A FRIEND

C20orf62

chromosome 20 open reading frame 62

26 Gene Product Result for
Synonyms: dJ1013A22.3
Species: Human C20orf62(140834)
UniProtKB ID: Q4KN68, A2A2S9, Q5QPC4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178476 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178476 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178476 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178476 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017344 predicted 222
2 SASI_Hs01_00017345 predicted 209
3 SASI_Hs01_00017346 predicted 229
4 SASI_Hs01_00017347 predicted 216
5 SASI_Hs01_00017348 predicted 230
6 SASI_Hs01_00017349 predicted 208
7 SASI_Hs01_00017350 predicted 222
8 SASI_Hs01_00017351 predicted 270
9 SASI_Hs01_00017352 predicted 263
10 SASI_Hs01_00017353 predicted 111
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178476
C20orf62 MISSION shRNA Bacterial Glycerol Stock
chromosome 20 open reading frame 62
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000180284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178476.1-208s1c1
Sequence:CCGGCGTATGTCTCACTGGACGTATCTCGAGATACGTCCAGTGAGACATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178476.1-306s1c1
Sequence:CCGGCAGGAAGCCTTACTGTCACTTCTCGAGAAGTGACAGTAAGGCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178476.1-230s1c1
Sequence:CCGGCCCAGGAACTGGTAAGCTATACTCGAGTATAGCTTACCAGTTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178476
C20orf62 MISSION shRNA shRNA Plasmid DNA
chromosome 20 open reading frame 62
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000180284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178476.1-208s1c1
Sequence:CCGGCGTATGTCTCACTGGACGTATCTCGAGATACGTCCAGTGAGACATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178476.1-306s1c1
Sequence:CCGGCAGGAAGCCTTACTGTCACTTCTCGAGAAGTGACAGTAAGGCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178476.1-230s1c1
Sequence:CCGGCCCAGGAACTGGTAAGCTATACTCGAGTATAGCTTACCAGTTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178476
C20orf62 MISSION shRNA Lentiviral Transduction Particles
chromosome 20 open reading frame 62
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000180284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178476.1-208s1c1
Sequence:CCGGCGTATGTCTCACTGGACGTATCTCGAGATACGTCCAGTGAGACATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178476.1-306s1c1
Sequence:CCGGCAGGAAGCCTTACTGTCACTTCTCGAGAAGTGACAGTAAGGCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178476.1-230s1c1
Sequence:CCGGCCCAGGAACTGGTAAGCTATACTCGAGTATAGCTTACCAGTTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks