EMAIL THIS PAGE TO A FRIEND

C20orf85

chromosome 20 open reading frame 85

23 Gene Product Result for
Synonyms: LLC1 bA196N14.1
Species: Human C20orf85(128602)
UniProtKB ID: Q9H1P6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178456 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178456 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178456 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178456 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042462 predicted 345
2 SASI_Hs01_00042463 predicted 440
3 SASI_Hs01_00042464 predicted 424
4 SASI_Hs02_00369694 predicted 230
5 SASI_Hs01_00042465 predicted 368
6 SASI_Hs01_00042466 predicted 431
7 SASI_Hs02_00369695 predicted 375
8 SASI_Hs01_00042468 predicted 313
9 SASI_Hs01_00042469 predicted 357
10 SASI_Hs01_00042470 predicted 312
11 SASI_Hs01_00042467 predicted 510
12 SASI_Hs01_00042471 predicted 448
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178456
C20orf85 MISSION shRNA Bacterial Glycerol Stock
chromosome 20 open reading frame 85
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178456.2-392s1c1
Sequence:CCGGCAGAAGCTGCAAAGGTGCTTTCTCGAGAAAGCACCTTTGCAGCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178456.2-384s1c1
Sequence:CCGGGATGCGATCAGAAGCTGCAAACTCGAGTTTGCAGCTTCTGATCGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178456.2-91s1c1
Sequence:CCGGGTCAGGATGAGATCTGGAAATCTCGAGATTTCCAGATCTCATCCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178456.2-101s1c1
Sequence:CCGGGATCTGGAAATACCGTCTGAACTCGAGTTCAGACGGTATTTCCAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178456.2-269s1c1
Sequence:CCGGCCCAGTGGAGAAGTACATCAACTCGAGTTGATGTACTTCTCCACTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178456.2-107s1c1
Sequence:CCGGGAAATACCGTCTGAAGGCTGACTCGAGTCAGCCTTCAGACGGTATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178456.2-183s1c1
Sequence:CCGGGAGGAGTTGATCAAGTGTGAACTCGAGTTCACACTTGATCAACTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178456.2-276s1c1
Sequence:CCGGGAGAAGTACATCAAGGTCTTTCTCGAGAAAGACCTTGATGTACTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178456.2-186s1c1
Sequence:CCGGGAGTTGATCAAGTGTGAAGAACTCGAGTTCTTCACACTTGATCAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162924    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178456.2-599s1c1
Sequence:CCGGGCCTTAGACATTCTCAAGTCACTCGAGTGACTTGAGAATGTCTAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178456
C20orf85 MISSION shRNA shRNA Plasmid DNA
chromosome 20 open reading frame 85
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178456.2-392s1c1
Sequence:CCGGCAGAAGCTGCAAAGGTGCTTTCTCGAGAAAGCACCTTTGCAGCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178456.2-384s1c1
Sequence:CCGGGATGCGATCAGAAGCTGCAAACTCGAGTTTGCAGCTTCTGATCGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178456.2-91s1c1
Sequence:CCGGGTCAGGATGAGATCTGGAAATCTCGAGATTTCCAGATCTCATCCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178456.2-101s1c1
Sequence:CCGGGATCTGGAAATACCGTCTGAACTCGAGTTCAGACGGTATTTCCAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178456.2-269s1c1
Sequence:CCGGCCCAGTGGAGAAGTACATCAACTCGAGTTGATGTACTTCTCCACTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178456.2-107s1c1
Sequence:CCGGGAAATACCGTCTGAAGGCTGACTCGAGTCAGCCTTCAGACGGTATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178456.2-183s1c1
Sequence:CCGGGAGGAGTTGATCAAGTGTGAACTCGAGTTCACACTTGATCAACTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178456.2-276s1c1
Sequence:CCGGGAGAAGTACATCAAGGTCTTTCTCGAGAAAGACCTTGATGTACTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178456.2-186s1c1
Sequence:CCGGGAGTTGATCAAGTGTGAAGAACTCGAGTTCTTCACACTTGATCAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162924    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178456.2-599s1c1
Sequence:CCGGGCCTTAGACATTCTCAAGTCACTCGAGTGACTTGAGAATGTCTAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178456
C20orf85 MISSION shRNA Lentiviral Transduction Particles
chromosome 20 open reading frame 85
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178456.2-392s1c1
Sequence:CCGGCAGAAGCTGCAAAGGTGCTTTCTCGAGAAAGCACCTTTGCAGCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178456.2-384s1c1
Sequence:CCGGGATGCGATCAGAAGCTGCAAACTCGAGTTTGCAGCTTCTGATCGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178456.2-91s1c1
Sequence:CCGGGTCAGGATGAGATCTGGAAATCTCGAGATTTCCAGATCTCATCCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178456.2-101s1c1
Sequence:CCGGGATCTGGAAATACCGTCTGAACTCGAGTTCAGACGGTATTTCCAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178456.2-269s1c1
Sequence:CCGGCCCAGTGGAGAAGTACATCAACTCGAGTTGATGTACTTCTCCACTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178456.2-107s1c1
Sequence:CCGGGAAATACCGTCTGAAGGCTGACTCGAGTCAGCCTTCAGACGGTATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178456.2-183s1c1
Sequence:CCGGGAGGAGTTGATCAAGTGTGAACTCGAGTTCACACTTGATCAACTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178456.2-276s1c1
Sequence:CCGGGAGAAGTACATCAAGGTCTTTCTCGAGAAAGACCTTGATGTACTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178456.2-186s1c1
Sequence:CCGGGAGTTGATCAAGTGTGAAGAACTCGAGTTCTTCACACTTGATCAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162924    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178456.2-599s1c1
Sequence:CCGGGCCTTAGACATTCTCAAGTCACTCGAGTGACTTGAGAATGTCTAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)