EMAIL THIS PAGE TO A FRIEND

C20orf96

chromosome 20 open reading frame 96

18 Gene Product Result for
Synonyms: dJ1103G7.2
UniProtKB ID: Q9NUD7, A3KPE0, B2RPH9, Q8N840, Q8NAX5
Gene ID:
chicken(419273) chromosome 20 open reading frame, human C20orf96
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153269 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153269 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153269 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001261 MISSION® esiRNA esiRNA targeting human C20orf96 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153269 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171799 predicted 975
2 SASI_Hs01_00171800 predicted 647
3 SASI_Hs01_00171801 predicted 765
4 SASI_Hs01_00171802 predicted 606
5 SASI_Hs01_00171803 predicted 900
6 SASI_Hs01_00171804 predicted 298
7 SASI_Hs02_00367148 predicted 601
8 SASI_Hs01_00171805 predicted 1064
9 SASI_Hs01_00171806 predicted 348
10 SASI_Hs01_00171807 predicted 887
11 SASI_Hs01_00171808 predicted 786
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153269
C20orf96 MISSION shRNA Bacterial Glycerol Stock
chromosome 20 open reading frame 96
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153269.1-1024s1c1
Sequence:CCGGCCTGAAATGCATGCAAAGGTTCTCGAGAACCTTTGCATGCATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153269.1-1133s1c1
Sequence:CCGGGAGGTCATATTTGAGGATGTTCTCGAGAACATCCTCAAATATGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153269.1-1045s1c1
Sequence:CCGGCAGAGAATTTATTGACCAGTTCTCGAGAACTGGTCAATAAATTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172895    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153269.1-1311s1c1
Sequence:CCGGGATCTCCATTCAGACCCTGATCTCGAGATCAGGGTCTGAATGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168722    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153269.1-1284s1c1
Sequence:CCGGGCCTTGGATCATTTACTTCCACTCGAGTGGAAGTAAATGATCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153269.1-1183s1c1
Sequence:CCGGCATGGATGTCATCCTCAACATCTCGAGATGTTGAGGATGACATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153269
C20orf96 MISSION shRNA shRNA Plasmid DNA
chromosome 20 open reading frame 96
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153269.1-1024s1c1
Sequence:CCGGCCTGAAATGCATGCAAAGGTTCTCGAGAACCTTTGCATGCATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153269.1-1133s1c1
Sequence:CCGGGAGGTCATATTTGAGGATGTTCTCGAGAACATCCTCAAATATGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153269.1-1045s1c1
Sequence:CCGGCAGAGAATTTATTGACCAGTTCTCGAGAACTGGTCAATAAATTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172895    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153269.1-1311s1c1
Sequence:CCGGGATCTCCATTCAGACCCTGATCTCGAGATCAGGGTCTGAATGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168722    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153269.1-1284s1c1
Sequence:CCGGGCCTTGGATCATTTACTTCCACTCGAGTGGAAGTAAATGATCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153269.1-1183s1c1
Sequence:CCGGCATGGATGTCATCCTCAACATCTCGAGATGTTGAGGATGACATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153269
C20orf96 MISSION shRNA Lentiviral Transduction Particles
chromosome 20 open reading frame 96
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153269.1-1024s1c1
Sequence:CCGGCCTGAAATGCATGCAAAGGTTCTCGAGAACCTTTGCATGCATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153269.1-1133s1c1
Sequence:CCGGGAGGTCATATTTGAGGATGTTCTCGAGAACATCCTCAAATATGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153269.1-1045s1c1
Sequence:CCGGCAGAGAATTTATTGACCAGTTCTCGAGAACTGGTCAATAAATTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172895    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153269.1-1311s1c1
Sequence:CCGGGATCTCCATTCAGACCCTGATCTCGAGATCAGGGTCTGAATGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168722    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153269.1-1284s1c1
Sequence:CCGGGCCTTGGATCATTTACTTCCACTCGAGTGGAAGTAAATGATCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153269.1-1183s1c1
Sequence:CCGGCATGGATGTCATCCTCAACATCTCGAGATGTTGAGGATGACATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks