EMAIL THIS PAGE TO A FRIEND

C21orf119

chromosome 21 open reading frame 119

43 Gene Product Result for
Species: Human C21orf119(84996)
UniProtKB ID: Q96HZ7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032910 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032910 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032910 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032910 Rosetta Predictions human pricing
XR_040263 Rosetta Predictions human pricing
XR_040264 Rosetta Predictions human pricing
XR_040265 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207743 predicted 384
2 SASI_Hs01_00207744 predicted 309
3 SASI_Hs01_00207745 predicted 220
4 SASI_Hs01_00207746 predicted 254
5 SASI_Hs01_00207747 predicted 343
6 SASI_Hs01_00207748 predicted 255
7 SASI_Hs01_00207749 predicted 307
8 SASI_Hs01_00207750 predicted 302
9 SASI_Hs01_00207751 predicted 263
10 SASI_Hs01_00207752 predicted 310
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040263 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517326 predicted 368
2 SASI_Hs02_00517327 predicted 297
3 SASI_Hs02_00517328 predicted 455
4 SASI_Hs02_00517329 predicted 324
5 SASI_Hs02_00517330 predicted 299
6 SASI_Hs02_00517331 predicted 320
7 SASI_Hs02_00517332 predicted 239
8 SASI_Hs02_00517333 predicted 287
9 SASI_Hs02_00517334 predicted 284
10 SASI_Hs02_00517335 predicted 548
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040264 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517336 predicted 371
2 SASI_Hs02_00517337 predicted 294
3 SASI_Hs02_00517338 predicted 453
4 SASI_Hs02_00517339 predicted 324
5 SASI_Hs02_00517340 predicted 302
6 SASI_Hs02_00517341 predicted 318
7 SASI_Hs02_00517342 predicted 239
8 SASI_Hs02_00517343 predicted 289
9 SASI_Hs02_00517344 predicted 275
10 SASI_Hs02_00517345 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517346 predicted 371
2 SASI_Hs02_00517347 predicted 293
3 SASI_Hs02_00517348 predicted 456
4 SASI_Hs02_00517349 predicted 323
5 SASI_Hs02_00517350 predicted 303
6 SASI_Hs02_00517351 predicted 326
7 SASI_Hs02_00517352 predicted 240
8 SASI_Hs02_00517353 predicted 294
9 SASI_Hs02_00517354 predicted 281
10 SASI_Hs02_00517355 predicted 551
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032910
C21orf119 MISSION shRNA Bacterial Glycerol Stock
chromosome 21 open reading frame 119
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000183670    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032910.2-577s1c1
Sequence:CCGGCAAACGAAGTAACGTCTGTAACTCGAGTTACAGACGTTACTTCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183055    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032910.2-626s1c1
Sequence:CCGGCACATCTAAGTTCCTGTCATTCTCGAGAATGACAGGAACTTAGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178962    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032910.2-337s1c1
Sequence:CCGGCAGGATTCGATACTTTGCCAACTCGAGTTGGCAAAGTATCGAATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032910
C21orf119 MISSION shRNA shRNA Plasmid DNA
chromosome 21 open reading frame 119
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000183670    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032910.2-577s1c1
Sequence:CCGGCAAACGAAGTAACGTCTGTAACTCGAGTTACAGACGTTACTTCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183055    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032910.2-626s1c1
Sequence:CCGGCACATCTAAGTTCCTGTCATTCTCGAGAATGACAGGAACTTAGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178962    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032910.2-337s1c1
Sequence:CCGGCAGGATTCGATACTTTGCCAACTCGAGTTGGCAAAGTATCGAATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032910
C21orf119 MISSION shRNA Lentiviral Transduction Particles
chromosome 21 open reading frame 119
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000183670    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032910.2-577s1c1
Sequence:CCGGCAAACGAAGTAACGTCTGTAACTCGAGTTACAGACGTTACTTCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183055    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032910.2-626s1c1
Sequence:CCGGCACATCTAAGTTCCTGTCATTCTCGAGAATGACAGGAACTTAGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178962    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032910.2-337s1c1
Sequence:CCGGCAGGATTCGATACTTTGCCAACTCGAGTTGGCAAAGTATCGAATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks