EMAIL THIS PAGE TO A FRIEND

C21orf128

chromosome 21 open reading frame 128

Species: Human C21orf128(150147)
UniProtKB ID: Q8N2C9
Gene ID:
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301244 ANTI-C21ORF128 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152507 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152507 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152507 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152507 Rosetta Predictions human pricing
XR_040363 Rosetta Predictions human pricing
XR_040364 Rosetta Predictions human pricing
XR_040365 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135459 predicted 383
2 SASI_Hs01_00135460 predicted 311
3 SASI_Hs01_00135461 predicted 626
4 SASI_Hs01_00135462 predicted 442
5 SASI_Hs01_00135463 predicted 543
6 SASI_Hs01_00135464 predicted 410
7 SASI_Hs01_00135465 predicted 695
8 SASI_Hs01_00135466 predicted 395
9 SASI_Hs01_00135467 predicted 548
10 SASI_Hs01_00135468 predicted 645
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040363 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518199 predicted 1907
2 SASI_Hs02_00518200 predicted 1900
3 SASI_Hs02_00518201 predicted 458
4 SASI_Hs02_00518202 predicted 1781
5 SASI_Hs02_00518203 predicted 701
6 SASI_Hs02_00518204 predicted 522
7 SASI_Hs02_00518205 predicted 1730
8 SASI_Hs02_00518206 predicted 770
9 SASI_Hs02_00518207 predicted 725
10 SASI_Hs02_00518208 predicted 548
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040364 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518209 predicted 1911
2 SASI_Hs02_00518210 predicted 1895
3 SASI_Hs02_00518211 predicted 453
4 SASI_Hs02_00518212 predicted 1781
5 SASI_Hs02_00518213 predicted 698
6 SASI_Hs02_00518214 predicted 513
7 SASI_Hs02_00518215 predicted 1733
8 SASI_Hs02_00518216 predicted 766
9 SASI_Hs02_00518217 predicted 728
10 SASI_Hs02_00518218 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040365 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518219 predicted 1906
2 SASI_Hs02_00518220 predicted 1895
3 SASI_Hs02_00518221 predicted 451
4 SASI_Hs02_00518222 predicted 1775
5 SASI_Hs02_00518223 predicted 696
6 SASI_Hs02_00518224 predicted 520
7 SASI_Hs02_00518225 predicted 1733
8 SASI_Hs02_00518226 predicted 432
9 SASI_Hs02_00518227 predicted 768
10 SASI_Hs02_00518228 predicted 722
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152507
C21orf128 MISSION shRNA Bacterial Glycerol Stock
chromosome 21 open reading frame 128
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152507.1-276s1c1
Sequence:CCGGCACTTCGGTACAAGTCAGACACTCGAGTGTCTGACTTGTACCGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152507.1-342s1c1
Sequence:CCGGGCAGACATCCATCAACGTCTTCTCGAGAAGACGTTGATGGATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168803    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152507.1-1700s1c1
Sequence:CCGGGCCCAGTATCTGGATTAAGTACTCGAGTACTTAATCCAGATACTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152507.1-253s1c1
Sequence:CCGGCACGATCTGCATTCTCAGCTTCTCGAGAAGCTGAGAATGCAGATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152507.1-249s1c1
Sequence:CCGGGAGACACGATCTGCATTCTCACTCGAGTGAGAATGCAGATCGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152507.1-354s1c1
Sequence:CCGGCAACGTCTTCACGACCATTAACTCGAGTTAATGGTCGTGAAGACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167590    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152507.1-1677s1c1
Sequence:CCGGGCACATATCTTAAAGATGGATCTCGAGATCCATCTTTAAGATATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167063    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152507.1-1663s1c1
Sequence:CCGGCCATTTGAATAAAGGCACATACTCGAGTATGTGCCTTTATTCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167030    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152507.1-1002s1c1
Sequence:CCGGCCAGAATATCTTTCCAAGGATCTCGAGATCCTTGGAAAGATATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152507
C21orf128 MISSION shRNA shRNA Plasmid DNA
chromosome 21 open reading frame 128
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152507.1-276s1c1
Sequence:CCGGCACTTCGGTACAAGTCAGACACTCGAGTGTCTGACTTGTACCGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152507.1-342s1c1
Sequence:CCGGGCAGACATCCATCAACGTCTTCTCGAGAAGACGTTGATGGATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168803    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152507.1-1700s1c1
Sequence:CCGGGCCCAGTATCTGGATTAAGTACTCGAGTACTTAATCCAGATACTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152507.1-253s1c1
Sequence:CCGGCACGATCTGCATTCTCAGCTTCTCGAGAAGCTGAGAATGCAGATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152507.1-249s1c1
Sequence:CCGGGAGACACGATCTGCATTCTCACTCGAGTGAGAATGCAGATCGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152507.1-354s1c1
Sequence:CCGGCAACGTCTTCACGACCATTAACTCGAGTTAATGGTCGTGAAGACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167590    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152507.1-1677s1c1
Sequence:CCGGGCACATATCTTAAAGATGGATCTCGAGATCCATCTTTAAGATATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167063    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152507.1-1663s1c1
Sequence:CCGGCCATTTGAATAAAGGCACATACTCGAGTATGTGCCTTTATTCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167030    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152507.1-1002s1c1
Sequence:CCGGCCAGAATATCTTTCCAAGGATCTCGAGATCCTTGGAAAGATATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152507
C21orf128 MISSION shRNA Lentiviral Transduction Particles
chromosome 21 open reading frame 128
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152507.1-276s1c1
Sequence:CCGGCACTTCGGTACAAGTCAGACACTCGAGTGTCTGACTTGTACCGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152507.1-342s1c1
Sequence:CCGGGCAGACATCCATCAACGTCTTCTCGAGAAGACGTTGATGGATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168803    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152507.1-1700s1c1
Sequence:CCGGGCCCAGTATCTGGATTAAGTACTCGAGTACTTAATCCAGATACTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152507.1-253s1c1
Sequence:CCGGCACGATCTGCATTCTCAGCTTCTCGAGAAGCTGAGAATGCAGATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152507.1-249s1c1
Sequence:CCGGGAGACACGATCTGCATTCTCACTCGAGTGAGAATGCAGATCGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152507.1-354s1c1
Sequence:CCGGCAACGTCTTCACGACCATTAACTCGAGTTAATGGTCGTGAAGACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167590    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152507.1-1677s1c1
Sequence:CCGGGCACATATCTTAAAGATGGATCTCGAGATCCATCTTTAAGATATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167063    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152507.1-1663s1c1
Sequence:CCGGCCATTTGAATAAAGGCACATACTCGAGTATGTGCCTTTATTCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167030    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152507.1-1002s1c1
Sequence:CCGGCCAGAATATCTTTCCAAGGATCTCGAGATCCTTGGAAAGATATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks