EMAIL THIS PAGE TO A FRIEND

C21orf2

chromosome 21 open reading frame 2

22 Gene Product Result for
Synonyms: YF5/A2
Species: Human C21orf2(755)
UniProtKB ID: O43822, A8MPS9, O14993, Q8N5X6, Q99837, Q99838
Gene ID:
Human(755) Summary: Four alternatively spliced transcript variants encoding four different isoforms have been found for this nuclear gene. All isoforms contain leucine-rich repeats. Three of these isoforms are mitochondrial proteins and one of them lacks the target peptide, so is not located in mitochondrion. This gene is down-regulated in Down syndrome (DS) brain, which may represent mitochondrial dysfunction in DS patients. [provided by RefSeq, Sep 2012]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004928 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004928 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004928 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151531 MISSION® esiRNA esiRNA human C21orf2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004928 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004928 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062502 predicted 1194
2 SASI_Hs01_00062503 predicted 1351
3 SASI_Hs01_00062504 predicted 1388
4 SASI_Hs01_00062505 predicted 1334
5 SASI_Hs01_00062506 predicted 1304
6 SASI_Hs01_00062507 predicted 1117
7 SASI_Hs01_00062508 predicted 1124
8 SASI_Hs01_00062509 predicted 1360
9 SASI_Hs01_00062510 predicted 1221
10 SASI_Hs01_00062511 predicted 1226
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004928
C21orf2 MISSION shRNA Bacterial Glycerol Stock
chromosome 21 open reading frame 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179224    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004928.1-1176s1c1
Sequence:CCGGGTTGTGACAGTCTTCCTGAAACTCGAGTTTCAGGAAGACTGTCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004928.1-162s1c1
Sequence:CCGGGATATCTCCATTTGCCAGGAGCTCGAGCTCCTGGCAAATGGAGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004928.2-675s21c1
Sequence:CCGGAGCTATGCTGCACACTGAGCTCTCGAGAGCTCAGTGTGCAGCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004928.2-338s21c1
Sequence:CCGGGTGATCACGCTCAGTGTCAACCTCGAGGTTGACACTGAGCGTGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004928.2-442s21c1
Sequence:CCGGTGAGCTCTTCTACCTGAAGGGCTCGAGCCCTTCAGGTAGAAGAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004928.2-294s21c1
Sequence:CCGGGCCTCACAGATATCTCCATTTCTCGAGAAATGGAGATATCTGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004928.2-1249s21c1
Sequence:CCGGGCAGGCTGTCCTCCCTAATAACTCGAGTTATTAGGGAGGACAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004928
C21orf2 MISSION shRNA shRNA Plasmid DNA
chromosome 21 open reading frame 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179224    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004928.1-1176s1c1
Sequence:CCGGGTTGTGACAGTCTTCCTGAAACTCGAGTTTCAGGAAGACTGTCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004928.1-162s1c1
Sequence:CCGGGATATCTCCATTTGCCAGGAGCTCGAGCTCCTGGCAAATGGAGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004928.2-675s21c1
Sequence:CCGGAGCTATGCTGCACACTGAGCTCTCGAGAGCTCAGTGTGCAGCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004928.2-338s21c1
Sequence:CCGGGTGATCACGCTCAGTGTCAACCTCGAGGTTGACACTGAGCGTGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004928.2-442s21c1
Sequence:CCGGTGAGCTCTTCTACCTGAAGGGCTCGAGCCCTTCAGGTAGAAGAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004928.2-294s21c1
Sequence:CCGGGCCTCACAGATATCTCCATTTCTCGAGAAATGGAGATATCTGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004928.2-1249s21c1
Sequence:CCGGGCAGGCTGTCCTCCCTAATAACTCGAGTTATTAGGGAGGACAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004928
C21orf2 MISSION shRNA Lentiviral Transduction Particles
chromosome 21 open reading frame 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179224    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004928.1-1176s1c1
Sequence:CCGGGTTGTGACAGTCTTCCTGAAACTCGAGTTTCAGGAAGACTGTCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004928.1-162s1c1
Sequence:CCGGGATATCTCCATTTGCCAGGAGCTCGAGCTCCTGGCAAATGGAGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004928.2-675s21c1
Sequence:CCGGAGCTATGCTGCACACTGAGCTCTCGAGAGCTCAGTGTGCAGCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004928.2-338s21c1
Sequence:CCGGGTGATCACGCTCAGTGTCAACCTCGAGGTTGACACTGAGCGTGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004928.2-442s21c1
Sequence:CCGGTGAGCTCTTCTACCTGAAGGGCTCGAGCCCTTCAGGTAGAAGAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004928.2-294s21c1
Sequence:CCGGGCCTCACAGATATCTCCATTTCTCGAGAAATGGAGATATCTGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004928.2-1249s21c1
Sequence:CCGGGCAGGCTGTCCTCCCTAATAACTCGAGTTATTAGGGAGGACAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks