EMAIL THIS PAGE TO A FRIEND

C21orf33

chromosome 21 open reading frame 33

62 Gene Product Result for
Synonyms: ES1 GT335 HES1 KNPH KNPI
Gene ID:
Human(8209) Summary: This gene encodes a potential mitochondrial protein that is a member of the DJ-1/PfpI gene family. This protein is overexpressed in fetal Down syndrome brain. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
sheep(100302318) chromosome 21 open reading frame 33
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2700774 Anti-C21orf33 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA018517 Anti-C21orf33 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
AV45817 Anti-C21ORF33 antibody produced in rabbit IgG fraction of antiserum , zebrafish, horse, canine, mouse, guinea pig, bovine, human, rat
immunohistochemistry, western blot pricing
WH0008209M1 Monoclonal Anti-C21orf33 antibody produced in mouse clone 1F5, purified immunoglobulin, buffered aqueous solution human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0051 AQUA Peptide EVVEAHVDQ[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004649 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004649 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004649 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198155 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198155 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198155 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004649 Rosetta Predictions human pricing
NM_198155 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044059 predicted 225
2 SASI_Hs01_00044060 predicted 243
3 SASI_Hs01_00044061 predicted 1370
4 SASI_Hs02_00338059 predicted 1312
5 SASI_Hs01_00044062 predicted 1365
6 SASI_Hs01_00044064 predicted 1286
7 SASI_Hs01_00044065 predicted 1266
8 SASI_Hs01_00044066 predicted 1277
9 SASI_Hs01_00044067 predicted 1256
10 SASI_Hs02_00338060 predicted 755
11 SASI_Hs01_00044063 predicted 1268
12 SASI_Hs01_00044068 predicted 532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198155 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182483 predicted 229
2 SASI_Hs01_00182484 predicted 241
3 SASI_Hs01_00182485 predicted 1281
4 SASI_Hs02_00371693 predicted 1220
5 SASI_Hs01_00182486 predicted 1272
6 SASI_Hs01_00182488 predicted 1196
7 SASI_Hs01_00182489 predicted 1167
8 SASI_Hs01_00182490 predicted 1192
9 SASI_Hs01_00182491 predicted 1170
10 SASI_Hs01_00182492 predicted 663
11 SASI_Hs01_00182487 predicted 1172
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004649
VALIDATED
C21orf33 MISSION shRNA Bacterial Glycerol Stock
chromosome 21 open reading frame 33
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004649.5-307s21c1
Sequence:CCGGGGGCTGAAGTCCAGATCTTTGCTCGAGCAAAGATCTGGACTTCAGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004649.5-1280s21c1
Sequence:CCGGGAAACCAGAAATACCACATTTCTCGAGAAATGTGGTATTTCTGGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004649.5-466s21c1
Sequence:CCGGACCATGATGCTGCCATCTTTCCTCGAGGAAAGATGGCAGCATCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004649.5-337s21c1
Sequence:CCGGTCCCTCAGATGCACGTGATTGCTCGAGCAATCACGTGCATCTGAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004649.5-684s21c1
Sequence:CCGGGAAGGTGGCAAGTGGCCTTATCTCGAGATAAGGCCACTTGCCACCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004649.4-1291s1c1
Sequence:CCGGCCACATTTATGGACCATGAAACTCGAGTTTCATGGTCCATAAATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141767    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004649.4-1392s1c1
Sequence:CCGGGAGAATAAACGCCTTCCCAAACTCGAGTTTGGGAAGGCGTTTATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004649.4-462s1c1
Sequence:CCGGCAACCATGATGCTGCCATCTTCTCGAGAAGATGGCAGCATCATGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004649.4-823s1c1
Sequence:CCGGGCACTCCACTACATCCATGATCTCGAGATCATGGATGTAGTGGAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004649.4-307s1c1
Sequence:CCGGGCTGAAGTCCAGATCTTTGCTCTCGAGAGCAAAGATCTGGACTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004649.4-310s1c1
Sequence:CCGGGAAGTCCAGATCTTTGCTCCTCTCGAGAGGAGCAAAGATCTGGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004649
VALIDATED
C21orf33 MISSION shRNA shRNA Plasmid DNA
chromosome 21 open reading frame 33
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004649.5-307s21c1
Sequence:CCGGGGGCTGAAGTCCAGATCTTTGCTCGAGCAAAGATCTGGACTTCAGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004649.5-1280s21c1
Sequence:CCGGGAAACCAGAAATACCACATTTCTCGAGAAATGTGGTATTTCTGGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004649.5-466s21c1
Sequence:CCGGACCATGATGCTGCCATCTTTCCTCGAGGAAAGATGGCAGCATCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004649.5-337s21c1
Sequence:CCGGTCCCTCAGATGCACGTGATTGCTCGAGCAATCACGTGCATCTGAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004649.5-684s21c1
Sequence:CCGGGAAGGTGGCAAGTGGCCTTATCTCGAGATAAGGCCACTTGCCACCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004649.4-1291s1c1
Sequence:CCGGCCACATTTATGGACCATGAAACTCGAGTTTCATGGTCCATAAATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141767    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004649.4-1392s1c1
Sequence:CCGGGAGAATAAACGCCTTCCCAAACTCGAGTTTGGGAAGGCGTTTATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004649.4-462s1c1
Sequence:CCGGCAACCATGATGCTGCCATCTTCTCGAGAAGATGGCAGCATCATGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004649.4-823s1c1
Sequence:CCGGGCACTCCACTACATCCATGATCTCGAGATCATGGATGTAGTGGAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004649.4-307s1c1
Sequence:CCGGGCTGAAGTCCAGATCTTTGCTCTCGAGAGCAAAGATCTGGACTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004649.4-310s1c1
Sequence:CCGGGAAGTCCAGATCTTTGCTCCTCTCGAGAGGAGCAAAGATCTGGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004649
VALIDATED
C21orf33 MISSION shRNA Lentiviral Transduction Particles
chromosome 21 open reading frame 33
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004649.5-307s21c1
Sequence:CCGGGGGCTGAAGTCCAGATCTTTGCTCGAGCAAAGATCTGGACTTCAGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004649.5-1280s21c1
Sequence:CCGGGAAACCAGAAATACCACATTTCTCGAGAAATGTGGTATTTCTGGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004649.5-466s21c1
Sequence:CCGGACCATGATGCTGCCATCTTTCCTCGAGGAAAGATGGCAGCATCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004649.5-337s21c1
Sequence:CCGGTCCCTCAGATGCACGTGATTGCTCGAGCAATCACGTGCATCTGAGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004649.5-684s21c1
Sequence:CCGGGAAGGTGGCAAGTGGCCTTATCTCGAGATAAGGCCACTTGCCACCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004649.4-1291s1c1
Sequence:CCGGCCACATTTATGGACCATGAAACTCGAGTTTCATGGTCCATAAATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141767    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004649.4-1392s1c1
Sequence:CCGGGAGAATAAACGCCTTCCCAAACTCGAGTTTGGGAAGGCGTTTATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004649.4-462s1c1
Sequence:CCGGCAACCATGATGCTGCCATCTTCTCGAGAAGATGGCAGCATCATGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004649.4-823s1c1
Sequence:CCGGGCACTCCACTACATCCATGATCTCGAGATCATGGATGTAGTGGAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004649.4-307s1c1
Sequence:CCGGGCTGAAGTCCAGATCTTTGCTCTCGAGAGCAAAGATCTGGACTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004649.4-310s1c1
Sequence:CCGGGAAGTCCAGATCTTTGCTCCTCTCGAGAGGAGCAAAGATCTGGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198155
VALIDATED
C21orf33 MISSION shRNA Bacterial Glycerol Stock
chromosome 21 open reading frame 33
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000140924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_198155.1-736s1c1
Sequence:CCGGCACTACATCCATGATGGGATCCTCGAGGATCCCATCATGGATGTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198155
VALIDATED
C21orf33 MISSION shRNA shRNA Plasmid DNA
chromosome 21 open reading frame 33
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000140924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_198155.1-736s1c1
Sequence:CCGGCACTACATCCATGATGGGATCCTCGAGGATCCCATCATGGATGTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198155
VALIDATED
C21orf33 MISSION shRNA Lentiviral Transduction Particles
chromosome 21 open reading frame 33
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000140924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_198155.1-736s1c1
Sequence:CCGGCACTACATCCATGATGGGATCCTCGAGGATCCCATCATGGATGTAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)