EMAIL THIS PAGE TO A FRIEND

C21orf49

chromosome 21 open reading frame 49

35 Gene Product Result for
Species: Human C21orf49(54067)
UniProtKB ID: Q17RA5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001006116 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001006116 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001006116 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006116 Rosetta Predictions human pricing
XR_017702 Rosetta Predictions human pricing
XR_041041 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006116 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036316 predicted 694
2 SASI_Hs01_00036317 predicted 509
3 SASI_Hs01_00036318 predicted 352
4 SASI_Hs01_00036319 predicted 488
5 SASI_Hs01_00036320 predicted 490
6 SASI_Hs01_00036321 predicted 372
7 SASI_Hs01_00036322 predicted 677
8 SASI_Hs01_00036323 predicted 1895
9 SASI_Hs01_00036324 predicted 2047
10 SASI_Hs01_00036325 predicted 1986
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017702 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00494052 predicted 641
2 SASI_Hs02_00494053 predicted 465
3 SASI_Hs02_00494054 predicted 423
4 SASI_Hs02_00494055 predicted 97
5 SASI_Hs02_00494056 predicted 86
6 SASI_Hs02_00494057 predicted 1027
7 SASI_Hs02_00494058 predicted 94
8 SASI_Hs02_00494059 predicted 109
9 SASI_Hs02_00494060 predicted 435
10 SASI_Hs02_00494061 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041041 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00524176 predicted 520
2 SASI_Hs02_00524177 predicted 482
3 SASI_Hs02_00524178 predicted 502
4 SASI_Hs02_00524179 predicted 511
5 SASI_Hs02_00524180 predicted 496
6 SASI_Hs02_00524181 predicted 483
7 SASI_Hs02_00524182 predicted 497
8 SASI_Hs02_00524183 predicted 503
9 SASI_Hs02_00524184 predicted 159
10 SASI_Hs02_00524185 predicted 641
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001006116
C21orf49 MISSION shRNA Bacterial Glycerol Stock
chromosome 21 open reading frame 49
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130704    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006116.1-880s1c1
Sequence:CCGGGCACCATCATACCCGACTAATCTCGAGATTAGTCGGGTATGATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006116.1-333s1c1
Sequence:CCGGGCCTTAAATTCCACAACCTCACTCGAGTGAGGTTGTGGAATTTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006116.1-328s1c1
Sequence:CCGGCCATGGCCTTAAATTCCACAACTCGAGTTGTGGAATTTAAGGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006116.1-343s1c1
Sequence:CCGGCCACAACCTCATCATCTACCACTCGAGTGGTAGATGATGAGGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006116.1-318s1c1
Sequence:CCGGCCAATTTGTCCCATGGCCTTACTCGAGTAAGGCCATGGGACAAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006116.1-377s1c1
Sequence:CCGGCAGAATCATGACTCTCAATGTCTCGAGACATTGAGAGTCATGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006116.1-364s1c1
Sequence:CCGGCCTTTGGTGCTTTCAGAATCACTCGAGTGATTCTGAAAGCACCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006116.1-503s1c1
Sequence:CCGGGACAAGAAGTTCCCAGAAGAACTCGAGTTCTTCTGGGAACTTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006116.1-1626s1c1
Sequence:CCGGCCAGCCAACATTGTGAGACATCTCGAGATGTCTCACAATGTTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001006116
C21orf49 MISSION shRNA shRNA Plasmid DNA
chromosome 21 open reading frame 49
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130704    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006116.1-880s1c1
Sequence:CCGGGCACCATCATACCCGACTAATCTCGAGATTAGTCGGGTATGATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006116.1-333s1c1
Sequence:CCGGGCCTTAAATTCCACAACCTCACTCGAGTGAGGTTGTGGAATTTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006116.1-328s1c1
Sequence:CCGGCCATGGCCTTAAATTCCACAACTCGAGTTGTGGAATTTAAGGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006116.1-343s1c1
Sequence:CCGGCCACAACCTCATCATCTACCACTCGAGTGGTAGATGATGAGGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006116.1-318s1c1
Sequence:CCGGCCAATTTGTCCCATGGCCTTACTCGAGTAAGGCCATGGGACAAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006116.1-377s1c1
Sequence:CCGGCAGAATCATGACTCTCAATGTCTCGAGACATTGAGAGTCATGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006116.1-364s1c1
Sequence:CCGGCCTTTGGTGCTTTCAGAATCACTCGAGTGATTCTGAAAGCACCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006116.1-503s1c1
Sequence:CCGGGACAAGAAGTTCCCAGAAGAACTCGAGTTCTTCTGGGAACTTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006116.1-1626s1c1
Sequence:CCGGCCAGCCAACATTGTGAGACATCTCGAGATGTCTCACAATGTTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001006116
C21orf49 MISSION shRNA Lentiviral Transduction Particles
chromosome 21 open reading frame 49
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130704    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006116.1-880s1c1
Sequence:CCGGGCACCATCATACCCGACTAATCTCGAGATTAGTCGGGTATGATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006116.1-333s1c1
Sequence:CCGGGCCTTAAATTCCACAACCTCACTCGAGTGAGGTTGTGGAATTTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006116.1-328s1c1
Sequence:CCGGCCATGGCCTTAAATTCCACAACTCGAGTTGTGGAATTTAAGGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006116.1-343s1c1
Sequence:CCGGCCACAACCTCATCATCTACCACTCGAGTGGTAGATGATGAGGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006116.1-318s1c1
Sequence:CCGGCCAATTTGTCCCATGGCCTTACTCGAGTAAGGCCATGGGACAAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006116.1-377s1c1
Sequence:CCGGCAGAATCATGACTCTCAATGTCTCGAGACATTGAGAGTCATGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006116.1-364s1c1
Sequence:CCGGCCTTTGGTGCTTTCAGAATCACTCGAGTGATTCTGAAAGCACCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006116.1-503s1c1
Sequence:CCGGGACAAGAAGTTCCCAGAAGAACTCGAGTTCTTCTGGGAACTTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006116.1-1626s1c1
Sequence:CCGGCCAGCCAACATTGTGAGACATCTCGAGATGTCTCACAATGTTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks