EMAIL THIS PAGE TO A FRIEND

C21orf58

chromosome 21 open reading frame 58

35 Gene Product Result for
Species: Human C21orf58(54058)
UniProtKB ID: P58505, B3KPI1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199071 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199071 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199071 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_058180 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_058180 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_058180 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU124181 MISSION® esiRNA esiRNA human C21orf58 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_058180 Rosetta Predictions human pricing
NM_199071 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058180 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362092 predicted 2415
2 SASI_Hs01_00243141 predicted 1398
3 SASI_Hs02_00362093 predicted 1448
4 SASI_Hs01_00243142 predicted 2421
5 SASI_Hs02_00362094 predicted 2428
6 SASI_Hs01_00243138 predicted 1786
7 SASI_Hs02_00362095 predicted 1566
8 SASI_Hs02_00362096 predicted 1473
9 SASI_Hs02_00362097 predicted 1576
10 SASI_Hs02_00362098 predicted 1415
11 SASI_Hs01_00243135 predicted 1783
12 SASI_Hs01_00243136 predicted 1785
13 SASI_Hs01_00243137 predicted 1786
14 SASI_Hs01_00243139 predicted 1436
15 SASI_Hs01_00243140 predicted 2491
16 SASI_Hs01_00243143 predicted 2508
17 SASI_Hs01_00243144 predicted 1302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199071 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148605 predicted 1301
2 SASI_Hs01_00148606 predicted 1172
3 SASI_Hs01_00148607 predicted 1407
4 SASI_Hs01_00148608 predicted 1518
5 SASI_Hs01_00148609 predicted 1295
6 SASI_Hs01_00148610 predicted 1511
7 SASI_Hs01_00148611 predicted 1176
8 SASI_Hs01_00148612 predicted 1437
9 SASI_Hs01_00148613 predicted 1444
10 SASI_Hs01_00148614 predicted 1688
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199071
C21orf58 MISSION shRNA Bacterial Glycerol Stock
chromosome 21 open reading frame 58
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000142275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199071.2-1296s1c1
Sequence:CCGGGCAGTTCTTTCCTGCGAGTAACTCGAGTTACTCGCAGGAAAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199071.2-1191s1c1
Sequence:CCGGCCAGAAACTTCCTTCTCCTGACTCGAGTCAGGAGAAGGAAGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144697    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199071.2-2503s1c1
Sequence:CCGGGATCAATAGCTTTAGCCACATCTCGAGATGTGGCTAAAGCTATTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199071
C21orf58 MISSION shRNA shRNA Plasmid DNA
chromosome 21 open reading frame 58
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000142275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199071.2-1296s1c1
Sequence:CCGGGCAGTTCTTTCCTGCGAGTAACTCGAGTTACTCGCAGGAAAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199071.2-1191s1c1
Sequence:CCGGCCAGAAACTTCCTTCTCCTGACTCGAGTCAGGAGAAGGAAGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144697    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199071.2-2503s1c1
Sequence:CCGGGATCAATAGCTTTAGCCACATCTCGAGATGTGGCTAAAGCTATTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199071
C21orf58 MISSION shRNA Lentiviral Transduction Particles
chromosome 21 open reading frame 58
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000142275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199071.2-1296s1c1
Sequence:CCGGGCAGTTCTTTCCTGCGAGTAACTCGAGTTACTCGCAGGAAAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199071.2-1191s1c1
Sequence:CCGGCCAGAAACTTCCTTCTCCTGACTCGAGTCAGGAGAAGGAAGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144697    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199071.2-2503s1c1
Sequence:CCGGGATCAATAGCTTTAGCCACATCTCGAGATGTGGCTAAAGCTATTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_058180
C21orf58 MISSION shRNA Bacterial Glycerol Stock
chromosome 21 open reading frame 58
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000122721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058180.2-1542s1c1
Sequence:CCGGCTGAAGAGAAGGAGGGACCTTCTCGAGAAGGTCCCTCCTTCTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058180.3-1830s21c1
Sequence:CCGGTCAACGGTCAGGAAGTATTAACTCGAGTTAATACTTCCTGACCGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058180.3-1881s21c1
Sequence:CCGGGAACGCACAGGTGCACCAGTTCTCGAGAACTGGTGCACCTGTGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058180.3-2425s21c1
Sequence:CCGGTCTTCCATCACGGAGGTAAAGCTCGAGCTTTACCTCCGTGATGGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_058180
C21orf58 MISSION shRNA shRNA Plasmid DNA
chromosome 21 open reading frame 58
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000122721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058180.2-1542s1c1
Sequence:CCGGCTGAAGAGAAGGAGGGACCTTCTCGAGAAGGTCCCTCCTTCTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058180.3-1830s21c1
Sequence:CCGGTCAACGGTCAGGAAGTATTAACTCGAGTTAATACTTCCTGACCGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058180.3-1881s21c1
Sequence:CCGGGAACGCACAGGTGCACCAGTTCTCGAGAACTGGTGCACCTGTGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058180.3-2425s21c1
Sequence:CCGGTCTTCCATCACGGAGGTAAAGCTCGAGCTTTACCTCCGTGATGGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_058180
C21orf58 MISSION shRNA Lentiviral Transduction Particles
chromosome 21 open reading frame 58
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000122721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058180.2-1542s1c1
Sequence:CCGGCTGAAGAGAAGGAGGGACCTTCTCGAGAAGGTCCCTCCTTCTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058180.3-1830s21c1
Sequence:CCGGTCAACGGTCAGGAAGTATTAACTCGAGTTAATACTTCCTGACCGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058180.3-1881s21c1
Sequence:CCGGGAACGCACAGGTGCACCAGTTCTCGAGAACTGGTGCACCTGTGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058180.3-2425s21c1
Sequence:CCGGTCTTCCATCACGGAGGTAAAGCTCGAGCTTTACCTCCGTGATGGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks