EMAIL THIS PAGE TO A FRIEND

C21orf59

chromosome 21 open reading frame 59

48 Gene Product Result for
Synonyms: C21orf48
UniProtKB ID: P57076
Gene ID:
Zebrafish(792532) c21orf59 homolog (H. sapiens)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021254 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021254 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021254 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_017835 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017835 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017835 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021254 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021254 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068739 predicted 273
2 SASI_Hs01_00068741 predicted 439
3 SASI_Hs01_00068742 predicted 710
4 SASI_Hs01_00068743 predicted 539
5 SASI_Hs01_00068744 predicted 294
6 SASI_Hs02_00354912 predicted 251
7 SASI_Hs01_00068745 predicted 391
8 SASI_Hs02_00354913 predicted 474
9 SASI_Hs01_00068748 predicted 706
10 SASI_Hs02_00354914 predicted 438
11 SASI_Hs01_00068740 predicted 439
12 SASI_Hs01_00068746 predicted 516
13 SASI_Hs01_00068747 predicted 461
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021254
C21orf59 MISSION shRNA Bacterial Glycerol Stock
chromosome 21 open reading frame 59
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021254.1-443s21c1
Sequence:CCGGAGTGTTAAAGAAGACTATAGACTCGAGTCTATAGTCTTCTTTAACACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021254.1-794s21c1
Sequence:CCGGTCCAGCCCGAGAGCCTATTATCTCGAGATAATAGGCTCTCGGGCTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021254.1-891s21c1
Sequence:CCGGGATGATGATGCCTATTTAAACCTCGAGGTTTAAATAGGCATCATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021254.1-408s21c1
Sequence:CCGGAGGAATGGGCAAGCTCCAAATCTCGAGATTTGGAGCTTGCCCATTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021254.1-761s21c1
Sequence:CCGGTATCGCCAAGATTCAGCAAAGCTCGAGCTTTGCTGAATCTTGGCGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021254.1-329s21c1
Sequence:CCGGATTGAAATTGAAGGATGAATGCTCGAGCATTCATCCTTCAATTTCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021254.1-836s21c1
Sequence:CCGGGCTGATGCTGTACTATCACAGCTCGAGCTGTGATAGTACAGCATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021254.1-625s21c1
Sequence:CCGGAGGAAGACTTGTCGGGAACACCTCGAGGTGTTCCCGACAAGTCTTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021254
C21orf59 MISSION shRNA shRNA Plasmid DNA
chromosome 21 open reading frame 59
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021254.1-443s21c1
Sequence:CCGGAGTGTTAAAGAAGACTATAGACTCGAGTCTATAGTCTTCTTTAACACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021254.1-794s21c1
Sequence:CCGGTCCAGCCCGAGAGCCTATTATCTCGAGATAATAGGCTCTCGGGCTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021254.1-891s21c1
Sequence:CCGGGATGATGATGCCTATTTAAACCTCGAGGTTTAAATAGGCATCATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021254.1-408s21c1
Sequence:CCGGAGGAATGGGCAAGCTCCAAATCTCGAGATTTGGAGCTTGCCCATTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021254.1-761s21c1
Sequence:CCGGTATCGCCAAGATTCAGCAAAGCTCGAGCTTTGCTGAATCTTGGCGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021254.1-329s21c1
Sequence:CCGGATTGAAATTGAAGGATGAATGCTCGAGCATTCATCCTTCAATTTCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021254.1-836s21c1
Sequence:CCGGGCTGATGCTGTACTATCACAGCTCGAGCTGTGATAGTACAGCATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021254.1-625s21c1
Sequence:CCGGAGGAAGACTTGTCGGGAACACCTCGAGGTGTTCCCGACAAGTCTTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021254
C21orf59 MISSION shRNA Lentiviral Transduction Particles
chromosome 21 open reading frame 59
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021254.1-443s21c1
Sequence:CCGGAGTGTTAAAGAAGACTATAGACTCGAGTCTATAGTCTTCTTTAACACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021254.1-794s21c1
Sequence:CCGGTCCAGCCCGAGAGCCTATTATCTCGAGATAATAGGCTCTCGGGCTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021254.1-891s21c1
Sequence:CCGGGATGATGATGCCTATTTAAACCTCGAGGTTTAAATAGGCATCATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021254.1-408s21c1
Sequence:CCGGAGGAATGGGCAAGCTCCAAATCTCGAGATTTGGAGCTTGCCCATTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021254.1-761s21c1
Sequence:CCGGTATCGCCAAGATTCAGCAAAGCTCGAGCTTTGCTGAATCTTGGCGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021254.1-329s21c1
Sequence:CCGGATTGAAATTGAAGGATGAATGCTCGAGCATTCATCCTTCAATTTCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021254.1-836s21c1
Sequence:CCGGGCTGATGCTGTACTATCACAGCTCGAGCTGTGATAGTACAGCATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021254.1-625s21c1
Sequence:CCGGAGGAAGACTTGTCGGGAACACCTCGAGGTGTTCCCGACAAGTCTTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017835
VALIDATED
C21orf59 MISSION shRNA Bacterial Glycerol Stock
chromosome 21 open reading frame 59
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_017835.1-650s1c1
Sequence:CCGGGACGAAGGAATGGGCAAGAAACTCGAGTTTCTTGCCCATTCCTTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_017835.1-877s1c1
Sequence:CCGGCAAGGAGCTGAGAAGAACGAACTCGAGTTCGTTCTTCTCAGCTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017835.1-703s1c1
Sequence:CCGGGATGGTGAAAGATGCCTTGGACTCGAGTCCAAGGCATCTTTCACCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137849    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_017835.1-827s1c1
Sequence:CCGGGCAGGGCTCAACGTCATTAAACTCGAGTTTAATGACGTTGAGCCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_017835.1-553s1c1
Sequence:CCGGCTGACCGATGATCAGATTGAACTCGAGTTCAATCTGATCATCGGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138091    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_017835.1-1043s1c1
Sequence:CCGGGAGGAGCTCAAGAGATTGGAACTCGAGTTCCAATCTCTTGAGCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017835
VALIDATED
C21orf59 MISSION shRNA shRNA Plasmid DNA
chromosome 21 open reading frame 59
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_017835.1-650s1c1
Sequence:CCGGGACGAAGGAATGGGCAAGAAACTCGAGTTTCTTGCCCATTCCTTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_017835.1-877s1c1
Sequence:CCGGCAAGGAGCTGAGAAGAACGAACTCGAGTTCGTTCTTCTCAGCTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017835.1-703s1c1
Sequence:CCGGGATGGTGAAAGATGCCTTGGACTCGAGTCCAAGGCATCTTTCACCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137849    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_017835.1-827s1c1
Sequence:CCGGGCAGGGCTCAACGTCATTAAACTCGAGTTTAATGACGTTGAGCCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_017835.1-553s1c1
Sequence:CCGGCTGACCGATGATCAGATTGAACTCGAGTTCAATCTGATCATCGGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138091    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_017835.1-1043s1c1
Sequence:CCGGGAGGAGCTCAAGAGATTGGAACTCGAGTTCCAATCTCTTGAGCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017835
VALIDATED
C21orf59 MISSION shRNA Lentiviral Transduction Particles
chromosome 21 open reading frame 59
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_017835.1-650s1c1
Sequence:CCGGGACGAAGGAATGGGCAAGAAACTCGAGTTTCTTGCCCATTCCTTCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_017835.1-877s1c1
Sequence:CCGGCAAGGAGCTGAGAAGAACGAACTCGAGTTCGTTCTTCTCAGCTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017835.1-703s1c1
Sequence:CCGGGATGGTGAAAGATGCCTTGGACTCGAGTCCAAGGCATCTTTCACCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137849    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_017835.1-827s1c1
Sequence:CCGGGCAGGGCTCAACGTCATTAAACTCGAGTTTAATGACGTTGAGCCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_017835.1-553s1c1
Sequence:CCGGCTGACCGATGATCAGATTGAACTCGAGTTCAATCTGATCATCGGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138091    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_017835.1-1043s1c1
Sequence:CCGGGAGGAGCTCAAGAGATTGGAACTCGAGTTCCAATCTCTTGAGCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)