EMAIL THIS PAGE TO A FRIEND

C21orf62

chromosome 21 open reading frame 62

51 Gene Product Result for
Synonyms: B37 C21orf120 PRED81
Species: Human C21orf62(56245)
UniProtKB ID: Q9NYP8, A8K4L8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019596 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019596 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019596 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU219111 MISSION® esiRNA esiRNA targeting human C21orf62 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019596 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019596 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138914 predicted 590
2 SASI_Hs01_00138915 predicted 787
3 SASI_Hs02_00352796 predicted 783
4 SASI_Hs01_00138918 predicted 299
5 SASI_Hs01_00138919 predicted 821
6 SASI_Hs02_00352797 predicted 729
7 SASI_Hs01_00138920 predicted 393
8 SASI_Hs01_00138921 predicted 723
9 SASI_Hs02_00352798 predicted 304
10 SASI_Hs01_00138922 predicted 387
11 SASI_Hs01_00138916 predicted 732
12 SASI_Hs01_00138917 predicted 654
13 SASI_Hs01_00138923 predicted 784
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019596
C21orf62 MISSION shRNA Bacterial Glycerol Stock
chromosome 21 open reading frame 62
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019596.1-612s1c1
Sequence:CCGGGAGCAGAGCTTACTCATCCATCTCGAGATGGATGAGTAAGCTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019596.1-862s1c1
Sequence:CCGGGCATAATAACTGTGTCCAGCTCTCGAGAGCTGGACACAGTTATTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019596.1-258s1c1
Sequence:CCGGGCACTTAACTGCTTCACCAAACTCGAGTTTGGTGAAGCAGTTAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019596.1-884s1c1
Sequence:CCGGCCTGGAACTTTGGCAAATGATCTCGAGATCATTTGCCAAAGTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019596.5-509s21c1
Sequence:CCGGTAGAGCGAACCAGCTACAATGCTCGAGCATTGTAGCTGGTTCGCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019596.5-931s21c1
Sequence:CCGGAGCTATGTTGTCACATTTATTCTCGAGAATAAATGTGACAACATAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019596.5-784s21c1
Sequence:CCGGCCATGTATGTATATCTCATTCCTCGAGGAATGAGATATACATACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019596
C21orf62 MISSION shRNA shRNA Plasmid DNA
chromosome 21 open reading frame 62
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019596.1-612s1c1
Sequence:CCGGGAGCAGAGCTTACTCATCCATCTCGAGATGGATGAGTAAGCTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019596.1-862s1c1
Sequence:CCGGGCATAATAACTGTGTCCAGCTCTCGAGAGCTGGACACAGTTATTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019596.1-258s1c1
Sequence:CCGGGCACTTAACTGCTTCACCAAACTCGAGTTTGGTGAAGCAGTTAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019596.1-884s1c1
Sequence:CCGGCCTGGAACTTTGGCAAATGATCTCGAGATCATTTGCCAAAGTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019596.5-509s21c1
Sequence:CCGGTAGAGCGAACCAGCTACAATGCTCGAGCATTGTAGCTGGTTCGCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019596.5-931s21c1
Sequence:CCGGAGCTATGTTGTCACATTTATTCTCGAGAATAAATGTGACAACATAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019596.5-784s21c1
Sequence:CCGGCCATGTATGTATATCTCATTCCTCGAGGAATGAGATATACATACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019596
C21orf62 MISSION shRNA Lentiviral Transduction Particles
chromosome 21 open reading frame 62
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019596.1-612s1c1
Sequence:CCGGGAGCAGAGCTTACTCATCCATCTCGAGATGGATGAGTAAGCTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019596.1-862s1c1
Sequence:CCGGGCATAATAACTGTGTCCAGCTCTCGAGAGCTGGACACAGTTATTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019596.1-258s1c1
Sequence:CCGGGCACTTAACTGCTTCACCAAACTCGAGTTTGGTGAAGCAGTTAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019596.1-884s1c1
Sequence:CCGGCCTGGAACTTTGGCAAATGATCTCGAGATCATTTGCCAAAGTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019596.5-509s21c1
Sequence:CCGGTAGAGCGAACCAGCTACAATGCTCGAGCATTGTAGCTGGTTCGCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019596.5-931s21c1
Sequence:CCGGAGCTATGTTGTCACATTTATTCTCGAGAATAAATGTGACAACATAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019596.5-784s21c1
Sequence:CCGGCCATGTATGTATATCTCATTCCTCGAGGAATGAGATATACATACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks