EMAIL THIS PAGE TO A FRIEND

C21orf67

chromosome 21 open reading frame 67

Synonyms: C21orf69 PRED54
Species: Human C21orf67(84536)
UniProtKB ID: P58512, P58556, Q495D3, Q495D5
Gene ID:
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302282 ANTI-C21ORF69 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_058188 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_058188 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_058188 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU158431 MISSION® esiRNA esiRNA human C21orf67 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_058188 Rosetta Predictions human pricing
XR_039924 Rosetta Predictions human pricing
XR_039925 Rosetta Predictions human pricing
XR_039926 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058188 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105932 predicted 740
2 SASI_Hs01_00105933 predicted 614
3 SASI_Hs01_00105934 predicted 507
4 SASI_Hs01_00105935 predicted 732
5 SASI_Hs01_00105936 predicted 713
6 SASI_Hs01_00105937 predicted 756
7 SASI_Hs01_00105938 predicted 773
8 SASI_Hs01_00105939 predicted 546
9 SASI_Hs01_00105940 predicted 614
10 SASI_Hs01_00105941 predicted 807
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514303 predicted 432
2 SASI_Hs02_00514304 predicted 409
3 SASI_Hs02_00514305 predicted 287
4 SASI_Hs02_00514306 predicted 407
5 SASI_Hs02_00514307 predicted 410
6 SASI_Hs02_00514308 predicted 413
7 SASI_Hs02_00514309 predicted 434
8 SASI_Hs02_00514310 predicted 386
9 SASI_Hs02_00514311 predicted 430
10 SASI_Hs02_00514312 predicted 447
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514313 predicted 430
2 SASI_Hs02_00514314 predicted 408
3 SASI_Hs02_00514315 predicted 291
4 SASI_Hs02_00514316 predicted 410
5 SASI_Hs02_00514317 predicted 408
6 SASI_Hs02_00514318 predicted 409
7 SASI_Hs02_00514319 predicted 434
8 SASI_Hs02_00514320 predicted 386
9 SASI_Hs02_00514321 predicted 424
10 SASI_Hs02_00514322 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514323 predicted 437
2 SASI_Hs02_00514324 predicted 414
3 SASI_Hs02_00514325 predicted 287
4 SASI_Hs02_00514326 predicted 405
5 SASI_Hs02_00514327 predicted 403
6 SASI_Hs02_00514328 predicted 412
7 SASI_Hs02_00514329 predicted 431
8 SASI_Hs02_00514330 predicted 389
9 SASI_Hs02_00514331 predicted 422
10 SASI_Hs02_00514332 predicted 444
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_058188
C21orf67 MISSION shRNA Bacterial Glycerol Stock
chromosome 21 open reading frame 67
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058188.1-868s1c1
Sequence:CCGGCTCTGCCAGTAGCTGCTTTAACTCGAGTTAAAGCAGCTACTGGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058188.1-389s1c1
Sequence:CCGGGTTAATCAGGAGTGGCCAGAACTCGAGTTCTGGCCACTCCTGATTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058188.1-876s1c1
Sequence:CCGGGTAGCTGCTTTAAAGGAGGGACTCGAGTCCCTCCTTTAAAGCAGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058188.1-368s1c1
Sequence:CCGGCCCTCACCAATAAGGAACTGTCTCGAGACAGTTCCTTATTGGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058188.1-372s1c1
Sequence:CCGGCACCAATAAGGAACTGTGTTACTCGAGTAACACAGTTCCTTATTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058188.1-772s1c1
Sequence:CCGGCAGAGGAAGATCAAAGATCAACTCGAGTTGATCTTTGATCTTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058188.1-507s1c1
Sequence:CCGGGCCAAGAGACAACAGCGATTACTCGAGTAATCGCTGTTGTCTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_058188
C21orf67 MISSION shRNA shRNA Plasmid DNA
chromosome 21 open reading frame 67
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058188.1-868s1c1
Sequence:CCGGCTCTGCCAGTAGCTGCTTTAACTCGAGTTAAAGCAGCTACTGGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058188.1-389s1c1
Sequence:CCGGGTTAATCAGGAGTGGCCAGAACTCGAGTTCTGGCCACTCCTGATTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058188.1-876s1c1
Sequence:CCGGGTAGCTGCTTTAAAGGAGGGACTCGAGTCCCTCCTTTAAAGCAGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058188.1-368s1c1
Sequence:CCGGCCCTCACCAATAAGGAACTGTCTCGAGACAGTTCCTTATTGGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058188.1-372s1c1
Sequence:CCGGCACCAATAAGGAACTGTGTTACTCGAGTAACACAGTTCCTTATTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058188.1-772s1c1
Sequence:CCGGCAGAGGAAGATCAAAGATCAACTCGAGTTGATCTTTGATCTTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058188.1-507s1c1
Sequence:CCGGGCCAAGAGACAACAGCGATTACTCGAGTAATCGCTGTTGTCTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_058188
C21orf67 MISSION shRNA Lentiviral Transduction Particles
chromosome 21 open reading frame 67
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058188.1-868s1c1
Sequence:CCGGCTCTGCCAGTAGCTGCTTTAACTCGAGTTAAAGCAGCTACTGGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058188.1-389s1c1
Sequence:CCGGGTTAATCAGGAGTGGCCAGAACTCGAGTTCTGGCCACTCCTGATTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058188.1-876s1c1
Sequence:CCGGGTAGCTGCTTTAAAGGAGGGACTCGAGTCCCTCCTTTAAAGCAGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058188.1-368s1c1
Sequence:CCGGCCCTCACCAATAAGGAACTGTCTCGAGACAGTTCCTTATTGGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058188.1-372s1c1
Sequence:CCGGCACCAATAAGGAACTGTGTTACTCGAGTAACACAGTTCCTTATTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058188.1-772s1c1
Sequence:CCGGCAGAGGAAGATCAAAGATCAACTCGAGTTGATCTTTGATCTTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058188.1-507s1c1
Sequence:CCGGGCCAAGAGACAACAGCGATTACTCGAGTAATCGCTGTTGTCTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks